RegulonDB RegulonDB 10.8: Gene Sequence
tsx gene sequence


Size: 885        A: 222  T: 216  G: 222  C: 225

Fasta

 

>tsx E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaaacattactggcagccggtgcggtactggcgctctcttcgtcttttactgtc
aacgcagctgaaaacgacaaaccgcagtatctttccgactggtggcaccagagcgttaac
gttgtcggaagctatcacacccgtttcggaccgcagatccgcaacgatacctaccttgag
tacgaagcattcgctaaaaaagactggttcgacttctatggttatgcggatgcgccggta
ttcttcggcggtaactccgatgctaaaggtatctggaaccacggttctccgctgtttatg
gaaatcgaaccacgtttctccatcgacaagctgaccaatactgaccttagcttcggtccg
ttcaaagagtggtacttcgcgaacaactacatttacgacatgggtcgtaataaagatggt
cgccagagcacctggtacatgggtctgggtaccgatatcgacactggcctgccgatgagc
ctgtccatgaacgtctatgcgaaataccagtggcagaactatggcgcagcgaacgaaaac
gagtgggacggttaccgtttcaaaattaaatactttgtgccgattaccgatctgtggggc
ggtcagctgagctacatcggcttcaccaacttcgactggggttccgatttaggggatgac
agcggtaacgcaatcaacggtattaagacccgtactaataactctatcgcttccagccat
attctggctctgaactacgatcactggcactactctgtcgtagctcgttactggcacgac
ggtggtcagtggaacgacgatgcagaactgaacttcggcaacggcaacttcaacgttcgc
tctaccggctggggtggttacctggtagtaggttacaacttctga
              
                            

Download fasta file
RegulonDB