RegulonDB RegulonDB 10.10: Gene Sequence
tyrA gene sequence


Size: 1122        A: 243  T: 292  G: 342  C: 245

Fasta

 

>tyrA E. coli K12. Version NC_000913.3 GI:556503834
atggttgctgaattgaccgcattacgcgatcaaattgatgaagtcgataaagcgctgctg
aatttattagcgaagcgtctggaactggttgctgaagtgggcgaggtgaaaagccgcttt
ggactgcctatttatgttccggagcgcgaggcatctatgttggcctcgcgtcgtgcagag
gcggaagctctgggtgtaccgccagatctgattgaggatgttttgcgtcgggtgatgcgt
gaatcttactccagtgaaaacgacaaaggatttaaaacactttgtccgtcactgcgtccg
gtggttatcgtcggcggtggcggtcagatgggacgcctgttcgagaagatgctgaccctc
tcgggttatcaggtgcggattctggagcaacatgactgggatcgagcggctgatattgtt
gccgatgccggaatggtgattgttagtgtgccaatccacgttactgagcaagttattggc
aaattaccgcctttaccgaaagattgtattctggtcgatctggcatcagtgaaaaatggg
ccattacaggccatgctggtggcgcatgatggtccggtgctggggctacacccgatgttc
ggtccggacagcggtagcctggcaaagcaagttgtggtctggtgtgatggacgtaaaccg
gaagcataccaatggtttctggagcaaattcaggtctggggcgctcggctgcatcgtatt
agcgccgtcgagcacgatcagaatatggcgtttattcaggcactgcgccactttgctact
tttgcttacgggctgcacctggcagaagaaaatgttcagcttgagcaacttctggcgctc
tcttcgccgatttaccgccttgagctggcgatggtcgggcgactgtttgctcaggatccg
cagctttatgccgacatcattatgtcgtcagagcgtaatctggcgttaatcaaacgttac
tataagcgtttcggcgaggcgattgagttgctggagcagggcgataagcaggcgtttatt
gacagtttccgcaaggtggagcactggttcggcgattacgcacagcgttttcagagtgaa
agccgcgtgttattgcgtcaggcgaatgacaatcgccagtaa
              
                            

Download fasta file
RegulonDB