RegulonDB RegulonDB 10.8: Gene Sequence
tyrP gene sequence


Size: 1212        A: 216  T: 375  G: 361  C: 260

Fasta

 

>tyrP E. coli K12. Version NC_000913.3 GI:556503834
gtgaaaaacagaaccctgggaagtgtttttatcgtggcgggaaccacaattggcgcaggc
atgctggcaatgccgctggctgcggccggtgttggttttagcgttacgttaatcttgttg
attgggctttgggcgttgatgtgctacacggcgctattactgctggaggtgtaccagcat
gttccggcagataccggtctgggcacgctggcaaaacgctatctgggacgctacggtcaa
tggctgacgggcttcagtatgatgttcttaatgtatgctctgactgcggcatacatcagc
ggtgccggtgaattgttggcctccagcatcagcgactggacaggtatttctatgtcggca
accgctggcgtgctgttgttcacttttgttgccggtggcgtggtttgtgtcggaacttca
ctggtcgatttatttaaccgttttctgttcagcgccaagattatttttctggtggtaatg
ctggtactactgctgccgcatattcacaaagtgaatcttttaaccctgccgttgcaacag
gggctggctctgtctgcaatcccggtgatttttacgtcgtttggttttcacggtagcgtg
ccgagtattgtcagctatatggatggcaacattcgtaagctacgctgggtgtttataatc
ggtagtgcgatccccctggtggcatatattttctggcaggtggcgacgcttggcagcatt
gattcaacaacctttatgggattgctggctaatcatgctggattaaacgggctgttacag
gcgttacgcgaaatggtggcctctccgcatgttgagctggcagtgcatttatttgctgat
ttagccctcgccacgtcatttctcggcgttgcgttaggcttatttgattatctggctgat
ttatttcagcgttcaaataccgttggtggacggttgcaaactggtgcaattacgtttctg
ccgccgttggcgtttgcactgttttatccacgaggatttgtgatggcgctgggttacgcc
ggtgtggcgctggcggtactggcattgattatcccttcgctgttgacctggcaaagcaga
aagcacaatcctcaggcgggttaccgggtcaaaggtggtcgtccggcgctggtggtggtg
tttctctgtggtattgctgtgattggcgtgcaatttttgattgcggcagggttgttacca
gaagtggggtga
              
                            

Download fasta file
RegulonDB