RegulonDB RegulonDB 10.7: Gene Sequence
uvrB gene sequence


Size: 2022        A: 490  T: 449  G: 581  C: 502

Fasta

 

>uvrB E. coli K12. Version NC_000913.3 GI:556503834
atgagtaaaccgttcaaactgaattccgcttttaaaccttctggcgatcagccagaggcg
attcgacgtctcgaagaggggctggaagatggcctggcgcaccagacgttacttggcgtg
actggctcagggaaaaccttcaccattgccaatgtcattgctgaccttcagcgcccaacc
atggtacttgcgcccaacaaaacgctggcggcccagctgtatggcgaaatgaaagagttc
ttcccggaaaacgcggtggaatatttcgtttcctactacgactactatcagccggaagcc
tatgtaccgagttccgacactttcattgagaaagatgcctcggttaacgaacatattgag
cagatgcgtttgtccgccaccaaagcgatgctggagcggcgtgatgtggttgtggtggcg
tctgtttccgcgatttatggtctgggcgatcctgatttatatctcaagatgatgctccat
ctcacggtcggtatgattatcgatcagcgcgcgattctgcgccgactggcggagctgcaa
tacgctcgtaatgatcaagcattccagcgtggtactttccgcgttcgtggcgaggtgata
gatatcttcccggcagaatcggatgacattgcacttcgcgtggaactgtttgacgaggaa
gtggaacgattgtcgttatttgacccgctgaccgggcagattgtttccactattccacgt
tttaccatctacccgaaaacgcactacgtcacaccgcgcgagcgcatcgtacaggcgatg
gaggagatcaaagaagagctggccgccagacgcaaagtgctgttggaaaacaacaaactg
ctggaagagcagcggctgacccagcgtacccagtttgatctggagatgatgaacgagctg
ggctactgttcggggattgaaaactactcgcgcttcctctccggtcgtggaccgggtgag
ccaccgccgacgctgtttgattacctgcctgccgatgggctgctggtcgtcgatgaatct
cacgtcaccattccacaaattggcggcatgtatcgcggtgaccgggcgcgtaaagagaca
ctggtggagtacggcttccgcctgccatcagcgctggataaccgtccgcttaagtttgaa
gagttcgaagcattagcgccgcaaaccatctatgtttcggcgacgccgggtaattacgag
ctggaaaaatccggcggcgatgtggtggatcaggtggtgcgtccaaccggattgcttgac
ccgattatcgaagtgcggccggtggcgacacaggttgatgatcttctttcggagattcgt
cagcgagcggcaattaacgaacgcgtactggtcaccacactgaccaagcggatggcggaa
gatcttaccgaatatctcgaagaacatggcgagcgcgtgcgttatcttcactcagatatc
gacaccgtcgaacgtatggagattatccgcgacttgcgtctgggtgagttcgacgtgctg
gtagggatcaacttactgcgcgaaggtctggatatgccggaagtgtcgctggtggcgatc
ctcgacgctgacaaagaaggcttcctgcgttccgaacgttcgttgatccagaccattggt
cgtgcggcacgtaacgttaacggtaaagcgattctctacggcgataagatcaccccatca
atggcgaaagcgattggcgaaaccgaacgtcgccgtgagaaacagcagaagtacaacgag
gaacacggaattacgccgcaaggcttgaacaagaaagtggtcgatatcctggcgctgggg
cagaacattgccaaaaccaaagcgaagggcagaggaaaatcgcgcccgattgttgagccg
gataatgtgccgatggatatgtcgcctaaagcgttgcagcagaaaatccatgagctggaa
gggttgatgatgcaacacgcgcagaatctggagttcgaagaagcggcgcaaattcgtgac
cagttgcatcagctgcgtgagctgtttatcgcggcatcgtaa
              
                            

Download fasta file
RegulonDB