RegulonDB RegulonDB 10.10: Gene Sequence
uvrD gene sequence


Size: 2163        A: 492  T: 423  G: 675  C: 573

Fasta

 

>uvrD E. coli K12. Version NC_000913.3 GI:556503834
atggacgtttcttacctgctcgacagccttaatgacaaacagcgcgaagcggtggccgcg
ccacgcagcaaccttctggtgctggcgggcgcgggcagtggtaagacgcgcgtactggtg
catcgtatcgcctggttgatgagcgtggaaaactgctcgccatactcgattatggcggtg
acgtttaccaacaaagcggcggcggagatgcgtcatcgtatcgggcaactgatgggcacg
agccagggcggtatgtgggtcggcaccttccacgggctggcgcaccgtttgctgcgtgcg
caccatatggacgccaatctgccgcaggatttccagatcctcgacagtgaagaccagcta
cgcctgcttaagcgtctgatcaaagccatgaacctcgacgagaagcagtggccgccgcgg
caggcaatgtggtacatcaacagccagaaagatgaaggcctgcgtccgcatcatattcaa
agctacggtaatccggtggagcagacctggcagaaggtgtatcaggcgtatcaggaagcg
tgtgaccgcgcgggcctggtggacttcgccgagctgctgctgcgcgctcacgagttgtgg
cttaacaagccgcatatcctgcaacactaccgcgaacgttttaccaatatcctggtggac
gaattccaggataccaacaacattcagtacgcgtggatccgcctgctggcgggcgacacc
ggcaaagtgatgatcgtcggtgatgacgaccagtcaatctacggctggcgcggggcgcag
gtggagaatattcagcgtttccttaatgatttccccggtgccgaaactattcgtctggag
caaaactaccgctctaccagcaatattctgagcgccgctaacgccctgattgaaaacaat
aacgggcgtctgggtaaaaaactgtggaccgatggcgcggacggtgagcctatttccctc
tattgcgcttttaacgaactcgatgaagcgcgttttgtggttaaccgcatcaaaacctgg
caggacaacggcggagcgcttgccgagtgcgccattctctaccgcagcaacgcccagtcg
cgggtgctcgaagaggcgttattgcaggccagtatgccgtaccgtatttacggcgggatg
cgcttcttcgaacgccaggaaatcaaagatgcgctctcgtatctgcgcctgattgccaac
cgcaacgacgacgcggcctttgagcgtgtggtgaatacgccaacgcggggtattggtgac
cggacgctggacgtggtacgtcagacatcgcgcgatcgccagttaacactctggcaggca
tgtcgtgagctgttgcaggaaaaagccctcgccgggcgagctgccagcgccttgcagcga
tttatggaattaatcgacgccttagcgcaggaaactgccgatatgccgctgcatgtacag
actgaccgggtaattaaagactccggcctgcgtaccatgtatgagcaggagaagggcgaa
aaaggtcagacgcgtatcgaaaacttagaggaactggtgacggcaacgcgccagttcagc
tacaacgaagaagacgaagatttaatgccgctgcaggcgttcctctcccatgcggcactg
gaagcaggtgaagggcaggcggatacctggcaggatgcggtgcagttgatgacgctacac
tcggcgaaaggcctggagttcccgcaggtgtttatcgttggtatggaagagggcatgttc
ccaagccagatgtcgctggatgaaggcgggcgtctggaagaagaacgccgtctggcctac
gttggcgtaacccgcgcgatgcagaaactgacgctgacctacgcggaaacccgccgtctg
tatggtaaagaggtttaccatcgcccgtcgcgctttatcggcgagctgccggaagagtgt
gtggaagaggtgcgcctgcgcgccacggtaagccgcccggtcagccatcagcggatgggt
acgccgatggtcgagaacgacagcggctacaagctcggccagcgcgtacgccacgctaag
tttggtgaaggcaccattgtcaatatggaaggcagcggtgagcatagccgtttgcaggtg
gcatttcagggccagggtattaaatggctggtggcggcatacgcccggctggagtcggtg
taa
              
                            

Download fasta file
RegulonDB