RegulonDB RegulonDB 10.10: Gene Sequence
uxaB gene sequence


Size: 1452        A: 347  T: 350  G: 394  C: 361

Fasta

 

>uxaB E. coli K12. Version NC_000913.3 GI:556503834
gtgaaaacactaaatcgtcgcgattttcccggtgcacagtatccagaacgtatcattcag
tttggtgaaggtaacttcctgcgcgcctttgttgactggcaaatcgatctcctgaatgag
cacaccgatctgaattctggcgtggtcgttgttcgtccgattgaaacttcattcccgccg
tcactgagcacgcaggatggtctgtacaccaccattatccgtggcctgaatgagaagggg
gaagcggtcagcgacgcgcgtctgattcgctcggttaatcgtgaaatcagcgtctacagt
gaatacgatgaattcctgaaactggcgcacaacccggaaatgcgctttgttttctctaac
accaccgaagcgggtatcagctaccatgcgggcgataaattcgatgacgcgccagcggta
agctatccggcaaaactgacccgtctgctgttcgaacgctttagccatttcaacggtgcg
ctggataaaggttggatcatcattccgtgtgagttgattgactacaatggcgacgcgttg
cgtgaactggtgctgcgctatgcgcaagagtgggcactgccagaagcatttattcaatgg
ctggatcaggctaacagcttctgttctacgctggtggaccgtatcgttaccggttatccg
cgcgatgaagtggctaaactggaagaagaactgggttatcacgatggttttctcgacacc
gctgaacacttttacctgtttgtgattcagggaccgaaatccttagcgactgaactgcgt
ctggacaaatatccgctcaacgtgctgattgttgacgatattaaaccgtacaaagaacgc
aaagtggcaatcctcaacggtgcgcacaccgcgctggtgccggtggcgttccaggcaggg
ctggataccgtaggtgaagcgatgaacgatgctgaaatttgcgcattcgttgaaaaagct
atctacgaagaaattattccggtactggatttgcctcgtgatgaactggaatctttcgcc
agtgcagtcaccgggcgtttccgtaacccgtacattaagcatcagctgctgtctatcgcg
ctcaacggtatgaccaagttccgcacccgcatcctgccacagctgctggcagggcagaag
gcaaacggcacacttccggcgcgccttactttcgcattagcggcattgattgcgttctat
cgtggtgagcgtaacggcgaaacatatccggtacaggacgatgcacactggctggaacgt
tatcagcaactctggagccagcatcgtgaccgtgttatcggcacccaggaactggtagcg
attgttttggcagaaaaagaccactgggagcaggacctgacgcaagtgcctggtctggtc
gagcaggttgctaatgacctggatgcgattctcgaaaaagggatgcgcgaagctgtacgt
ccgttgtgctaa
              
                            

Download fasta file
RegulonDB