RegulonDB RegulonDB 10.10: Gene Sequence
uxuA gene sequence


Size: 1185        A: 296  T: 245  G: 319  C: 325

Fasta

 

>uxuA E. coli K12. Version NC_000913.3 GI:556503834
atggaacagacctggcgctggtacggcccaaacgatccggtttctttagctgatgtccgt
caggcgggcgcaactggcgtggttaccgcgctgcaccatatcccgaacggcgaagtatgg
tccgttgaagagatcctcaaacgcaaggcgatcattgaagacgcaggcctggtgtggtct
gtcgtagaaagcgtgccaattcacgaagatatcaaaacccacactggcaactatgagcag
tggatcgctaactatcagcagactctgcgcaacctggcgcagtgtggcattcgcaccgtg
tgctacaacttcatgccggtgctcgactggacccgtactgacctcgaatacgtgctgcca
gacggctccaaagctctgcgcttcgaccagatcgaattcgctgcattcgaaatgcatatc
ctgaaacgcccaggcgcggaagcggattacaccgaagaagaaattgctcaggcagctgaa
cgcttcgccactatgagcgatgaagacaaagcgcgtctgacccgtaacatcattgctggt
cttccgggcgcggaagaaggctacaccctcgaccagttccgtaaacacctggagctgtac
aaagatatcgacaaagcgaagctgcgcgaaaactttgccgtcttcctgaaagcgattatt
ccagttgctgaagaagtcggcgtgcgtatggctgttcacccggacgatccgccgcgcccg
atcctcggcctgccgcgcattgtttccaccattgaagatatgcagtggatggttgatacc
gtaaacagcatggcaaacggttttaccatgtgcaccggttcctacggcgtgcgtgctgac
aacgatctggttgatatgatcaagcagttcggtccgcgtatttacttcacccatctgcgc
tccaccatgcgtgaagataacccgaaaaccttccacgaagcggcgcacctgaacggtgac
gttgatatgtacgaagtggtgaaagcgattgttgaagaagaacaccgtcgtaaagcggaa
ggcaaagaagacctgatcccgatgcgtccggaccacggtcatcagatgctggacgacctg
aagaagaaaaccaacccaggttactccgcaattggtcgtctgaaaggcctggccgaagtt
cgcggtgtcgaactggcgatccagcgcgctttctttagccgttaa
              
                            

Download fasta file
RegulonDB