RegulonDB RegulonDB 10.10: Gene Sequence
xerC gene sequence


Size: 897        A: 206  T: 207  G: 256  C: 228

Fasta

 

>xerC E. coli K12. Version NC_000913.3 GI:556503834
atgaccgatttacacaccgatgtagaacgctacctacgttatctgagcgtggagcgccag
cttagcccgataaccctgcttaactaccagcgtcagcttgaggcgatcatcaattttgcc
agcgaaaacggcctgcaaagctggcagcaatgtgatgtgacgatggtgcgcaattttgct
gtacgcagtcgccgtaaagggctgggagcagcaagtctggcgttacggctttctgcgcta
cgtagcttttttgactggctggtcagccagaacgaactcaaagctaacccggcgaaaggt
gtttcggcaccgaaagcgccgcgtcatctgccgaaaaacatcgacgtcgacgatatgaat
cggctgctggatattgatatcaatgatcccctcgctgtacgcgaccgtgcaatgctggaa
gtgatgtacggcgcgggtctgcgtctttctgagctggtggggctggatattaaacacctc
gacctggagtctggtgaagtgtgggttatggggaaaggcagcaaagagcgccgcctgccg
attggtcgcaacgctgtggcgtggattgagcactggcttgatttgcgcgacctgtttggt
agcgaagacgacgcgctttttctgtcgaaactgggcaagcgtatctccgcgcgtaatgtg
cagaaacgctttgccgaatggggcataaaacaagggctgaataatcacgttcatccgcat
aaattacgtcactcgttcgccacgcatatgctggagtcgagcggcgatcttcgtggtgtg
caggagctgctgggtcatgccaacctctccaccacgcaaatctatactcatcttgatttt
caacaccttgcctcggtgtacgatgcggcgcatccacgcgccaaacgggggaaataa
              
                            

Download fasta file
RegulonDB