RegulonDB RegulonDB 10.8: Gene Sequence
xseA gene sequence


Size: 1371        A: 353  T: 288  G: 359  C: 371

Fasta

 

>xseA E. coli K12. Version NC_000913.3 GI:556503834
atgttaccttctcaatcccctgcaatttttaccgttagtcgcctgaatcaaacggttcgt
ctgctgcttgagcatgagatgggacaggtttggatcagcggcgaaatttctaatttcacg
caaccagcttccggtcactggtactttacactcaaagacgacaccgcccaggtacgctgc
gcgatgttccgcaacagcaaccgccgggtgaccttccgcccacagcatgggcaacaagtt
ttagttcgcgccaatattacgctctacgagccgcgcggcgactaccagataatcgttgag
agtatgcagccggccggtgaagggctgctgcaacagaagtacgaacagctcaaagcgaag
ttgcaggctgaaggtttgttcgatcagcaatacaaaaaaccacttccctcccctgcgcat
tgcgttggtgtgatcacctcaaaaaccggtgctgcgctacatgatattttgcatgtgtta
aaacgtcgcgatccttctctgccggtgatcatctaccctgccgccgttcagggcgatgac
gcgccggggcaaattgttcgcgccattgaactggcgaatcagcgcaatgagtgcgacgta
ttgatcgtcgggcgcggcggcggttcgctggaagatttatggagttttaacgacgaacgc
gtagcgcgggcgatttttaccagccgcattccggttgtcagcgccgtcgggcatgagacg
gatgtgaccattgccgattttgttgccgatctgcgtgcgccaacgccgtctgccgccgct
gaagtagtgagccgtaatcagcaagagttactgcgccaggtgcaatcgacccgtcaacgg
ctggagatggcgatggattattatctcgccaaccgcacacgtcgctttacgcaaattcat
caccgattacagcaacagcatccgcagctccggctggcacgccagcaaaccatgcttgag
cgcctgcaaaagcgaatgagctttgcgctggaaaatcaacttaagcgtaccgggcaacag
cagcagcggttaacacagcggctgaatcagcaaaatccacagccgaagattcatcgcgcg
caaacgcgcattcagcaactggaatatcgtttagcagaaaccctgcgcgcacagcttagc
gccacgcgtgaacgtttcggtaatgcagtaacgcacctcgaagccgtaagcccactgtca
acgctggcgcgtggatacagcgttactactgctactgacggcaatgtactgaaaaaagtg
aagcaagttaaagcgggtgaaatgctaaccacacgtctggaagacggctggatagaaagt
gaagtaaaaaacatccagccagtaaaaaaatcgcgtaaaaaggtgcattaa
              
                            

Download fasta file
RegulonDB