RegulonDB RegulonDB 11.0: Gene Sequence
xylB gene sequence


Size: 1455        A: 318  T: 340  G: 454  C: 343

Fasta

 

>xylB E. coli K12. Version NC_000913.3 GI:556503834
atgtatatcgggatagatcttggcacctcgggcgtaaaagttattttgctcaacgagcag
ggtgaggtggttgctgcgcaaacggaaaagctgaccgtttcgcgcccgcatccactctgg
tcggaacaagacccggaacagtggtggcaggcaactgatcgcgcaatgaaagctctgggc
gatcagcattctctgcaggacgttaaagcattgggtattgccggccagatgcacggagca
accttgctggatgctcagcaacgggtgttacgccctgccattttgtggaacgacgggcgc
tgtgcgcaagagtgcactttgctggaagcgcgagttccgcaatcgcgggtgattaccggc
aacctgatgatgcccggatttactgcgcctaaattgctatgggttcagcggcatgagccg
gagatattccgtcaaatcgacaaagtattattaccgaaagattacttgcgtctgcgtatg
acgggggagtttgccagcgatatgtctgacgcagctggcaccatgtggctggatgtcgca
aagcgtgactggagtgacgtcatgctgcaggcttgcgacttatctcgtgaccagatgccc
gcattatacgaaggcagcgaaattactggtgctttgttacctgaagttgcgaaagcgtgg
ggtatggcgacggtgccagttgtcgcaggcggtggcgacaatgcagctggtgcagttggt
gtgggaatggttgatgctaatcaggcaatgttatcgctggggacgtcgggggtctatttt
gctgtcagcgaagggttcttaagcaagccagaaagcgccgtacatagcttttgccatgcg
ctaccgcaacgttggcatttaatgtctgtgatgctgagtgcagcgtcgtgtctggattgg
gccgcgaaattaaccggcctgagcaatgtcccagctttaatcgctgcagctcaacaggct
gatgaaagtgccgagccagtttggtttctgccttatctttccggcgagcgtacgccacac
aataatccccaggcgaagggggttttctttggtttgactcatcaacatggccccaatgaa
ctggcgcgagcagtgctggaaggcgtgggttatgcgctggcagatggcatggatgtcgtg
catgcctgcggtattaaaccgcaaagtgttacgttgattgggggcggggcgcgtagtgag
tactggcgtcagatgctggcggatatcagcggtcagcagctcgattaccgtacggggggg
gatgtggggccagcactgggcgcagcaaggctggcgcagatcgcggcgaatccagagaaa
tcgctcattgaattgttgccgcaactaccgttagaacagtcgcatctaccagatgcgcag
cgttatgccgcttatcagccacgacgagaaacgttccgtcgcctctatcagcaacttctg
ccattaatggcgtaa
              
                            

Download fasta file
RegulonDB