RegulonDB RegulonDB 10.8: Gene Sequence
nhaR gene sequence


Size: 906        A: 233  T: 243  G: 227  C: 203

Fasta

 

>nhaR E. coli K12. Version NC_000913.3 GI:556503834
atgagcatgtctcatatcaattacaaccacttgtattacttctggcatgtctataaagaa
ggttccgtggttggcgcagcggaggcgctttatttaactccacaaaccattaccggacag
attcgagcgctggaagagcgcctgcaaggcaaattatttaaacgcaagggacgtggtctc
gaacccagcgagctgggagaactggtctatcgctatgccgataaaatgttcaccttaagc
caggaaatgctggatattgtgaactatcgcaaagaatccaatttattgtttgacgttggc
gtggctgatgcactttccaaacgcctggtcagtagcgtacttaacgccgcagtggtagaa
ggcgagcccattcatcttcgctgcttcgaatccacccacgaaatgctgctggagcaatta
agtcagcataaactggatatgatcatttctgactgtccgatagactctacgcagcaggaa
ggcctgttctccgtgagaattggcgaatgtggcgtgagtttctggtgtacaaatccacca
ccagaaaaaccgttcccggcttgtctggaagaacggcgacttttgattcctgggcgacgt
tcaatgttagggcgcaaattgcttaactggtttaactcccagggattaaacgtagaaatc
ctcggcgagtttgatgatgccgctttgatgaaagcttttggtgcgatgcacaatgcaatc
ttcgttgccccaacgctttatgcatatgacttttatgccgataaaactgtcgtagaaatt
ggtcgcgtcgagaatgtgatggaagagtaccatgctatttttgctgagcggatgattcag
cacccggcggtacagcgaatctgcaatacggattattctgcgctttttagtccagcggtg
cgttaa
              
                            

Download fasta file
RegulonDB