RegulonDB RegulonDB 10.8: Gene Sequence
ribF gene sequence


Size: 942        A: 211  T: 226  G: 278  C: 227

Fasta

 

>ribF E. coli K12. Version NC_000913.3 GI:556503834
atgaagctgatacgcggcatacataatctcagccaggccccgcaagaagggtgtgtgctg
actattggtaatttcgacggcgtgcatcgcggtcatcgcgcgctgttacagggcttgcag
gaagaagggcgcaagcgcaacttaccggtgatggtgatgctttttgaacctcaaccactg
gaactgtttgctaccgataaagccccggcaagactgacccggctgcgggaaaaactgcgt
taccttgcagagtgtggcgttgattacgtgctgtgcgtgcgtttcgacaggcgtttcgcg
gcgttaaccgcgcaaaatttcatcagcgatcttctggtgaagcatttgcgcgtaaaattt
cttgccgtaggtgatgatttccgctttggcgctggtcgtgaaggcgatttcttgttatta
cagaaagctggcatggaatacggcttcgatatcaccagtacgcaaactttttgcgaaggt
ggcgtgcgcatcagcagcaccgccgtgcgtcaggcccttgcggatgacaatctggctctg
gcagagagtttactggggcacccgtttgccatctccgggcgtgtagtccacggtgatgaa
ttagggcgcactataggtttcccgacggcgaatgtaccgctgcgccgtcaggtttccccg
gtgaaaggggtttatgcggtagaagtgctgggcctcggtgaaaagccgttacccggcgtg
gcaaacatcggaacacgcccaacggttgccggtattcgccagcagctggaagtgcatttg
ttagatgttgcaatggacctttacggtcgccatatacaagtagtgctgcgtaaaaaaata
cgcaatgagcagcgatttgcgtcgctggacgaactgaaagcgcagattgcgcgtgatgaa
ttaaccgcccgcgaattttttgggctaacaaaaccggcttaa
              
                            

Download fasta file
RegulonDB