RegulonDB RegulonDB 10.8: Gene Sequence
fkpB gene sequence


Size: 450        A: 100  T: 105  G: 125  C: 120

Fasta

 

>fkpB E. coli K12. Version NC_000913.3 GI:556503834
atgtctgaatctgtacagagcaatagcgccgtcctggtgcacttcacgctaaaactcgac
gatggcaccaccgccgagtctacccgcaacaacggtaaaccggcgctgttccgcctgggt
gatgcttctctttctgaagggctggagcaacacctgttggggctgaaagtgggcgataaa
accaccttctcgttggagccagatgcggcgtttggcgtgccgtcaccggacctgattcag
tacttctcccgccgtgaatttatggatgcaggcgagccagaaattggcgcaatcatgctt
tttaccgcaatggatggcagtgagatgcctggcgtgatccgcgaaattaacggcgactcc
attaccgttgatttcaaccatccgctggccgggcagaccgttcattttgatattgaagtg
ctggaaatcgatccggcactggaggcgtaa
              
                            

Download fasta file
RegulonDB