RegulonDB RegulonDB 10.8: Gene Sequence
ispH gene sequence


Size: 951        A: 220  T: 207  G: 296  C: 228

Fasta

 

>ispH E. coli K12. Version NC_000913.3 GI:556503834
atgcagatcctgttggccaacccgcgtggtttttgtgccggggtagaccgcgctatcagc
attgttgaaaacgcgctggccatttacggcgcaccgatatatgtccgtcacgaagtggta
cataaccgctatgtggtcgatagcttgcgtgagcgtggggctatctttattgagcagatt
agcgaagtaccggacggcgcgatcctgattttctccgcacacggtgtttctcaggcggta
cgtaacgaagcaaaaagtcgcgatttgacggtgtttgatgccacctgtccgctggtgacc
aaagtgcatatggaagtcgcccgcgccagtcgccgtggcgaagaatctattctcatcggt
cacgccgggcacccggaagtggaagggacaatgggccagtacagtaacccggaaggggga
atgtatctggtcgaatcgccggacgatgtgtggaaactgacggtcaaaaacgaagagaag
ctctcctttatgacccagaccacgctgtcggtggatgacacgtctgatgtgatcgacgcg
ctgcgtaaacgcttcccgaaaattgtcggtccgcgcaaagatgacatctgctacgccacg
actaaccgtcaggaagcggtacgcgccctggcagaacaggcggaagttgtgttggtggtc
ggttcgaaaaactcctccaactccaaccgtctggcggagctggcccagcgtatgggcaaa
cgcgcgtttttgattgacgatgcgaaagacatccaggaagagtgggtgaaagaggttaaa
tgcgtcggcgtgactgcgggcgcatcggctccggatattctggtgcagaatgtggtggca
cgtttgcagcagctgggcggtggtgaagccattccgctggaaggccgtgaagaaaacatt
gttttcgaagtgccgaaagagctgcgtgtcgatattcgtgaagtcgattaa
              
                            

Download fasta file
RegulonDB