RegulonDB RegulonDB 10.8: Gene Sequence
rihC gene sequence


Size: 915        A: 181  T: 219  G: 256  C: 259

Fasta

 

>rihC E. coli K12. Version NC_000913.3 GI:556503834
atgcgtttacctatcttcctcgatactgaccccggcattgacgatgccgtcgccattgcc
gccgcgatttttgcacccgaactcgacctgcaactgatgaccaccgtcgcgggtaatgtc
tcggttgagaaaactacccgcaatgccctgcaactgctgcatttctggaatgcggagatt
ccgctcgcccaaggggccgctgtgccactggtacgcgcaccgcgtgatgcggcatctgtg
cacggcgaatcgggaatggctggctacgactttgttgagcacaaccgaaagccgctcggg
ataccggcgtttctggcgattcgggatgccctgatgcgtgcaccagagcctgttaccctg
gtggccatcggcccgttaaccaatattgcgctgttactttcacaatgcccggaatgcaag
ccgtatattcgccgtctggtgatcatgggtggttctgccggacgcggcaactgtacgcca
aacgccgagtttaatattgctgccgatccagaagctgctgcctgtgtcttccgcagtggt
attgaaatcgtcatgtgcggtttggatgtcaccaatcaggcaatattaactcctgactat
ctctctacactgccgcagttaaaccgtaccgggaaaatgcttcacgccctgtttagccac
taccgtagcggcagtatgcaaagcggcttgcgaatgcacgatctctgcgccatcgcctgg
ctggtgcgcccggacctgttcactctcaaaccctgttttgtggcagtggaaactcagggc
gaatttacctcaggcacgacggtggttgatatcgacggttgcctgggcaagccagccaat
gtacaggtggcattggatctggatgtgaaaggcttccagcagtgggtggctgaggtgctg
gctctggcgtcgtaa
              
                            

Download fasta file
RegulonDB