RegulonDB RegulonDB 10.8: Gene Sequence
acpH gene sequence


Size: 582        A: 119  T: 154  G: 153  C: 156

Fasta

 

>acpH E. coli K12. Version NC_000913.3 GI:556503834
atgaattttttagctcacctgcatttagcccatctcgcggaaagctcgctttccggcaat
ttactggctgatttcgtacgcggaaatcctgaagaaagttttccgcccgacgtcgtggct
ggcattcatatgcatcgacgtatcgacgtattgactgacaatctgccggaagtccgcgaa
gcacgggagtggtttcgtagtgaaacgcgccgcgttgcgcctattacgctggatgtcatg
tgggatcactttctttcccgccactggtcgcagctgtcgccggactttccgctacaggaa
tttgtctgttatgcccgcgagcaagtgatgacgattttgccggactcaccgccacgtttt
atcaatctgaacaattacttgtggtcagagcagtggctggtgcgctatcgcgatatggat
ttcatccagaacgtgttaaacggcatggcaagccgccgcccacgtctggatgccctgcgt
gactcctggtacgatttagacgctcattatgacgccctcgaaacccgcttctggcagttt
tatccgcggatgatggcgcaggcgtcacgcaaggcgttataa
              
                            

Download fasta file
RegulonDB