RegulonDB RegulonDB 10.8: Gene Sequence
yajC gene sequence


Size: 333        A: 84  T: 84  G: 90  C: 75

Fasta

 

>yajC E. coli K12. Version NC_000913.3 GI:556503834
atgagcttttttatttctgatgcggtagcggcaacgggtgcaccggcgcaaggtagcccg
atgtctttgattttgatgctggtggtattcggtctgattttctatttcatgatcctgcgt
ccacagcagaagcgcaccaaagaacacaaaaagctgatggactccattgccaaaggtgat
gaagttctgacgaacggtggcctggttggtcgcgtaaccaaagtagcggaaaacggctac
attgctatcgcgctgaatgacaccactgaagtagttattaaacgtgacttcgtagctgcc
gtcctgccgaaaggcaccatgaaggcgctgtaa
              
                            

Download fasta file
RegulonDB