RegulonDB RegulonDB 10.8: Gene Sequence
yajD gene sequence


Size: 348        A: 105  T: 79  G: 86  C: 78

Fasta

 

>yajD E. coli K12. Version NC_000913.3 GI:556503834
atggctatcatcccaaaaaactatgcgcggttagaaagcggctatcgcgaaaaagcatta
aaaatctatccgtgggtctgcggtcgctgttcccgcgagtttgtttattccaacctgcgt
gaacttaccgttcaccacattgatcacgaccataccaataacccggaagatggcagtaac
tgggaattgttgtgtctctattgccacgatcatgagcattcgaaatataccgaagcggat
cagtatggtacgaccgttatcgcaggggaagatgcgcagaaagatgtcggtgaagcgaag
tacaacccattcgctgacctgaaagcgatgatgaacaagaagaagtga
              
                            

Download fasta file
RegulonDB