RegulonDB RegulonDB 10.8: Gene Sequence
yfcA gene sequence


Size: 810        A: 157  T: 226  G: 225  C: 202

Fasta

 

>yfcA E. coli K12. Version NC_000913.3 GI:556503834
atggaaacgtttaatagcctgtttatggtttccccgctgttgctgggagttctctttttt
gtcgccatgctggcgggatttatcgactcgattgccggtggcggtgggttactcaccatt
ccggcattgatggcagcggggatgtctcccgctaatgcgctggcaaccaataaactgcaa
gcctgcggcggctctatttccgctactatctactttattcgccgcaaagtggttagttta
agcgatcagaaactcaatatcgccatgacctttgtcggctcaatgagcggcgcactgctg
gtgcaatacgttcaggctgatgtcttacggcagattttgcccattctggtaatttgtatc
ggcctctatttcttgctgatgccaaagctaggtgaagaagaccgccagcgccggatgtac
ggtttacccttcgcgttaatagccggtggctgcgtcggtttttatgatggattctttggc
ccggctgccgggtcgttttacgcgctggccttcgttacgctgtgcggatttaacctcgcc
aaagccacggctcacgccaaattactcaacgcaacgtcaaacatcggcggtttactgctg
tttattctcggcggcaaagtgatttgggcgacgggctttgtcatgctggtggggcagttc
ctcggcgcgcgcatgggttcacgactggtgttgagcaaaggacaaaagctgatccgcccg
atgattgttatcgtctcggcggtgatgagtgccaaattactttacgacagccacggacag
gagatcctccactggttggggatgaactaa
              
                            

Download fasta file
RegulonDB