RegulonDB RegulonDB 10.8: Gene Sequence
pdeA gene sequence


Size: 2190        A: 480  T: 637  G: 568  C: 505

Fasta

 

>pdeA E. coli K12. Version NC_000913.3 GI:556503834
atgtttgtggagcataacctgataaaaaatatcaagatattcacactagcgtttacgctc
accgtggtacttattcagctatcccgttttatttcgccacttgccattatccattccagt
tatatctttctggcgtggatgccactgtgcgtaatgctgtcaatcttgtttatctttggc
tggcgcggtgtcgttcccgttttatgcgggatgttttgcaccaatctgtggaactttcat
ctctcttttttacagactgcggtcatgctcggtagccagacgtttgtcgtgttgtgtgcc
tgcgcaatattacgctggcagctggggacgcgttggcgttatggattgaccagccgatat
gtctggcaacgtctgttctggcttggtttggtgacgccgatcggcatcaaatgcagcatg
tatcttgtggggagcttctttgatttcccgctaaagatatccacctttttcggcgatgcg
gatgccattttcacggtcgttgatttgctaagccttttcaccgctgtgctgatttacaac
atgcttttctactatctcactcgcatgattgtaagtccccactttgcgcagatattgtgg
cgcagggatatcgctccgtcgttgggcaaagagaaacgcgcatttaccttaagctggctg
gcagcgttaagcgtgctgctacttctgttgtgcacaccttatgaaaacgactttattgcc
ggttacctggtacccgttttcttcatcatctttaccctcggggtcggtaagcttcgctat
ccgtttttaaatctcacctgggctgtttcaacgctttgccttctgaattacaaccagaac
tttttgcaaggggtggaaaccgaatattcgctggcatttattcttgcggtgctgatttcc
tttagcgtttgcctgctctatatggtgcgcatttatcatcgcagtgaatggcttaatcgc
cgctggcatttgcaggcgctgacagatccgttaacgctcctacccaactttcgtgcgttg
gaacaagcgccggagcaagaggcgggcaagagtttttgctgcctgcgcattgataatctt
gagtttatgagtcgtcattacggcttaatgatgcgcgttcactgtatccgctcaatttgc
cgtacgctgctgccgttgatgcaggaaaacgaaaagttgtatcaattgccgggtagtgaa
ctgctgttagtgctgagcgggccggaaacggaagggcgactccagcatatggttaacatc
ctgaatagtcggcaaattcactggaacaataccgggctggatatgggctatggtgctgcc
tgggggcgttttgatggaaatcaggaaaccctgcaacccttgttggggcagttaagctgg
ctggcggagcaatcctgcgcacatcatcatgtgctggcgctggatagcagagaggagatg
gtttccgggcagaccactaaacaggtgctattgctgaataccattcgcacggcgttagat
cagggtgatttgctgctctacgcccagccaattcgcaacaaagagggtgaaggttatgat
gagatcctcgcgcgactgaaatatgacggcggcattatgaccccggataagtttctgccc
cttattgctcagtttaaccttagcgcgcgttttgatttgcaagtgctggaatccttgttg
aagtggctggcaacacacccttgcgacaaaaaaggaccgcgcttttcagtcaatttaatg
ccgctcacgctgctgcaaaagaatattgccgggcggattattcgtctgtttaagcgttat
cacatctccccgcaggcggtcattcttgagatcaccgaggagcaggcgttttctaacgca
gaaagcagcatgtacaacatcgagcagctgcataagtttggtttccggattgcgattgat
gactttggcaccggatatgccaactacgaacggttaaagcgtttgcaggctgatatcatc
aaaattgatggcgtctttgtgaaagatattgtcacgaacacgctggatgcgatgattgtg
agatcaattaccgatctggcgaaagcgaagtcattgagtgtggtcgcggagtttgtcgag
acgcaacagcagcaggcgctattgcataagctcggggtgcaatatctgcaagggtatttg
attggtcgcccgcagccattagctgattaa
              
                            

Download fasta file
RegulonDB