RegulonDB RegulonDB 11.0: Gene Sequence
ygiC gene sequence


Size: 1161        A: 303  T: 276  G: 308  C: 274

Fasta

 

>ygiC E. coli K12. Version NC_000913.3 GI:556503834
atggaaagagtcagtattaccgagcgcccggactggcgtgagaaagcccacgaatacggt
ttcaattttcacaccatgtacggcgagccgtactggtgtgaagatgcttactacaagttg
accctcgcccaggttgaaaagctggaagaagtcaccgccgaactgcaccagatgtgcctg
aaagtggtggaaaaagtgatcgccagcgatgagctgatgaccaaattccgcattccaaaa
cacacctggagttttgtgcgccagtcatggctgacgcaccagccatcgctttattcgcgt
cttgatctggcgtgggatggcactggtgaacctaaacttctggaaaataacgccgatacg
ccaacgtcactatacgaggcggcgttctttcagtggatctggctggaagatcagcttaac
gccggtaacttgccggagggcagcgaccagtttaacagtctgcaagaaaaactgatcgat
cgcttcgttgagctgcgtgaacagtatggcttccagttgctgcatctcacctgctgtcgc
gacacggtggaagatcgcggaaccattcagtatttgcaggactgcgcaacggaagctgaa
attgctactgagttcctctacatcgatgatatcgggttaggtgaaaaaggtcagttcacg
gatttacaggatcaggtaatttccaacctgttcaaactgtatccgtgggaatttatgttg
cgtgagatgttctcaaccaagctggaggatgcaggcgtacgctggctggaaccggcgtgg
aagagcattatctccaacaaggcacttctaccgctactgtgggagatgttcccgaatcac
ccgaacctgctgcccgcttattttgcggaagatgatcatccgcaaatggaaaaatatgtg
gttaaaccgatcttctcccgtgaaggcgcaaacgtgtcgatcattgagaacggcaaaacc
attgaagcagcggaaggtccgtatggcgaagaagggatgattgttcagcaattccacccg
ttaccgaaattcggcgacagctatatgctgattggtagctggctggtgaacgatcaaccc
gccggaattggcattcgtgaagaccgtgcattgatcacccaggatatgtctcggttttat
ccacatatttttgttgaataa
              
                            

Download fasta file
RegulonDB