RegulonDB RegulonDB 10.10: Gene Sequence
yhfA gene sequence


Size: 405        A: 95  T: 101  G: 124  C: 85

Fasta

 

>yhfA E. coli K12. Version NC_000913.3 GI:556503834
atgcaagcgcgagtgaagtgggtcgaagggttaacttttctgggcgaatccgcctctggt
catcagattttaatggacggcaactcaggcgataaagcaccaagtccgatggaaatggtg
ttgatggcggcgggtggttgcagtgccatcgatgtggtttcgatcctgcaaaaagggcgt
caggatgtggtcgattgtgaagtaaaattgacctctgaacgccgcgaagaggcaccacgc
ctgtttacgcacattaatctgcattttatcgtcaccggtcgcgacctgaaagacgcagcg
gttgcgcgtgcggttgatctctctgccgagaaatattgttcagtggcgttgatgctggaa
aaagcggtgaatattactcactcgtatgaagtggttgccgcgtga
              
                            

Download fasta file
RegulonDB