RegulonDB RegulonDB 10.10: Gene Sequence
waaC gene sequence


Size: 960        A: 249  T: 221  G: 273  C: 217

Fasta

 

>waaC E. coli K12. Version NC_000913.3 GI:556503834
atgcgggttttgatcgttaaaacatcgtcgatgggcgatgttctccatacgttgcccgca
ctcactgatgcccagcaggcaatcccagggattaagtttgactgggtggtggaagaaggg
ttcgcacagattccttcctggcacgctgccgttgagcgagttattcctgtggcaatacgt
cgctggcgtaaagcctggttctcggcccccataaaagcggaacgcaaagcgtttcgtgaa
gcgctacaagcagagaactatgacgcagttatcgacgctcaggggctggtaaaaagcgcg
gcgctggtgacgcgtctggcgcatggcgtaaagcatggcatggactggcaaaccgctcgc
gaacctttagccagcctgttttacaatcgtaagcatcatattgcaaaacagcagcacgcc
gtagaacgcacccgcgaactgtttgccaaaagtttgggctatagcaaaccgcaaacccag
ggcgattatgctatcgcacagcattttctgacgaacctgcctacagatgctggcgaatat
gccgtatttcttcatgcgacgacccgtgatgataaacactggccggaagaacactggcga
gaattgattggtttactggctgattcaggaatacggattaaacttccgtggggcgcgccg
catgaggaagaacgggcgaaacgactggcggaaggatttgcttatgttgaagtattgccg
aagatgagtctggaaggcgttgcccgcgtgctggccggggctaaatttgtagtgtcggtg
gatacggggttaagccatttaacggcggcactggatagacccaatatcacggtttatgga
ccaaccgatccgggattaattggtgggtatgggaagaatcagatggtatgtagggctcca
agagaaaatttaattaacctcaacagtcaagcagttttggaaaagttatcatcattataa
              
                            

Download fasta file
RegulonDB