RegulonDB RegulonDB 10.9: Gene Sequence
glmU gene sequence


Size: 1371        A: 339  T: 310  G: 396  C: 326

Fasta

 

>glmU E. coli K12. Version NC_000913.3 GI:556503834
atgttgaataatgctatgagcgtagtgatccttgccgcaggcaaaggcacgcgcatgtat
tccgatcttccgaaagtgctgcatacccttgccgggaaagcgatggttcagcatgtcatt
gatgctgcgaatgaattaggcgcagcgcacgttcacctggtgtacggtcacggcggcgat
ctgctaaaacaggcgctgaaagacgacaaccttaactgggtgcttcaggcagagcagctg
ggtacgggtcatgcaatgcagcaggccgcacctttctttgccgatgatgaagacatttta
atgctctacggcgacgtgccgctgatctctgtcgaaacactccagcgtctgcgtgatgct
aaaccgcagggtggcattggtctgctgacggtgaaactggatgatccgaccggttatgga
cgtatcacccgtgaaaacggcaaagttaccggcattgttgagcacaaagatgccaccgac
gagcagcgtcagattcaggagatcaacaccggcattctgattgccaacggcgcagatatg
aaacgctggctggcgaagctgaccaacaataatgctcagggcgaatactacatcaccgac
attattgcgctggcgtatcaggaagggcgtgaaatcgtcgccgttcatccgcaacgttta
agcgaagtagaaggcgtgaataaccgcctgcaactctcccgtctggagcgtgtttatcag
tccgaacaggctgaaaaactgctgttagcaggcgttatgctgcgcgatccagcgcgtttt
gatctgcgtggtacgctaactcacgggcgcgatgttgaaattgatactaacgttatcatc
gagggcaacgtgactctcggtcatcgcgtgaaaattggcaccggttgcgtgattaaaaac
agcgtgattggcgatgattgcgaaatcagtccgtataccgttgtggaagatgcgaatctg
gcagcggcctgtaccattggcccgtttgcccgtttgcgtcctggtgctgagttgctggaa
ggtgctcacgtcggtaacttcgttgagatgaaaaaagcgcgtctgggtaaaggctcgaaa
gctggtcatctgacttacctgggcgatgcggaaattggcgataacgttaacatcggcgcg
ggaaccattacctgcaactacgatggtgcgaataaatttaagaccattatcggcgacgat
gtgtttgttggttccgacactcagctggtggccccggtaacagtaggcaaaggcgcgacc
attgctgcgggtacaactgtgacgcgtaatgtcggcgaaaatgcattagctatcagccgt
gtgccgcagactcagaaagaaggctggcgtcgtccggtaaagaaaaagtga
              
                            

Download fasta file
RegulonDB