RegulonDB RegulonDB 10.9: Gene Sequence
yigA gene sequence


Size: 708        A: 147  T: 166  G: 216  C: 179

Fasta

 

>yigA E. coli K12. Version NC_000913.3 GI:556503834
atgaagcaaccaggggaagaactgcaggaaacactcacggagcttgatgaccgggcggtt
gtcgattatctgattaaaaatcctgagttttttatccgtaatgcgcgcgcagtagaagcg
atacgtgtgccgcatccggtacgcggcaccgtttcgttggtcgagtggcacatggcccgc
gcacgtaatcatattcatgttctggaagagaacatggcgctgttgatggaacaggctatc
gccaacgaaggcctgttttatcgcctactctacctgcagcgcagtctcaccgccgccagc
agtctcgacgatatgctgatgcgctttcaccgctgggcgcgcgatctcggcctggcaggt
gcgagtctgcgcctgtttccggatcgctggcgcttaggtgcgccgtcgaaccacactcat
ctggcattaagccgtcagtctttcgaaccgctgcgtattcagcgtttggggcaggaacag
cactatcttgggccgcttaacggaccagagctgctggtggtgctaccggaagcgaaagcg
gtgggatcggtggcgatgtcgatgctgggaagcgatgctgatttgggtgtcgtgctgttt
accagtcgcgatgccagtcactatcaacaagggcaaggaacgcagttacttcatgaaatt
gcgctgatgttgccggagcttctggagcgttggattgaacgcgtatga
              
                            

Download fasta file
RegulonDB