RegulonDB RegulonDB 10.9: Gene Sequence
yigB gene sequence


Size: 717        A: 159  T: 158  G: 208  C: 192

Fasta

 

>yigB E. coli K12. Version NC_000913.3 GI:556503834
atgcgtttttaccggcctttggggcgcatctcggcgctcacctttgacctggatgatacc
ctttacgataaccgtccggtgattttgcgcaccgagcgagaggcgcttacctttgtgcaa
aattatcatccggcgctgcgcagcttccagaatgaagatctgcaacgcctgcgccaggcg
gtacgggaagcggaacccgagatttatcacgacgtgacgcgctggcgttttcgttcgatt
gaacaagcgatgctcgacgccgggctgagtgccgaagaagccagtgcaggcgcacacgca
gcaatgatcaactttgccaaatggcgcagccgaatcgacgtcccgcagcaaactcacgac
accttaaaacagctggcgaagaaatggccgctggtggcgatcaccaacggtaacgcccag
ccggagctgtttggtttgggggattattttgagtttgtgctgcgcgctggcccgcacggg
cgctcaaaaccgttcagcgatatgtactttttggctgcggaaaaactcaacgtgccgatc
ggcgagatcttacatgttggggacgatctcaccactgacgtgggtggggcaattcgcagc
ggaatgcaggcttgttggatcagaccggaaaatggcgatctgatgcaaacctgggacagc
cgtttactgccgcatctggaaatttcccggttggcatctctgacctcgctgatataa
              
                            

Download fasta file
RegulonDB