RegulonDB RegulonDB 11.0: Gene Sequence
arpA gene sequence


Size: 2187        A: 729  T: 635  G: 399  C: 424

Fasta

 

>arpA E. coli K12. Version NC_000913.3 GI:556503834
atgattactcgtattcctcgtagttctttctctgcaaatattaataatacagcccagaca
aatgaacaccaaaccctgagtgaattgttttataaagaactcgaggataaattttctggc
aaggagctggcgacgcctctattaaaaagcttctcagagaactgtagacaaaatggtcgt
catatctttagcaacaaggattttgtcattaaattttccacgtccgtcttacaagctgat
aagaaagaaattacgataattaataaaaacgaaaacacgacacttactcaaaccattgcc
ccaatatttgaaaaatacctaatggaaattttacctcaacgctcagacactcttgataaa
caagaattaaacctaaaatcagatagaaaagaaaaagaattcccaagaattaaacttaat
ggtcaatgttattttccggggcgaccccaaaaccgtatagtatgccgacacattgctgca
caatatattaatgatatttatcagaatgttgattacaaaccccatcaagatgattactct
tcagctgaaaaatttctcacgcacttcaacaaaaaatgcaaaaaccagactttggcgttg
gtttccagccgtcctgaggggcgttgcgttgctgcctgcggtgatttcgggctagttatg
aaagcatattttgacaagatggaatcaaatggcatcagtgttatggcagccatattactg
gtggataaccatgctttgacggtccggctaagaataaagaacacaactgaaggatgtacc
cattacgtggtttcggtttatgatcctaatgtaactaacgataaaataagaattatgagc
gaaagcaaagagaatattaaacactattctctgatggattttatgaatgtagattatagc
ctcctgaaatggtcaaatgatcatgttattaatcaatctgttgcaataattccagcactt
ccgaaagaacagctattgatgttaaaaggatctgtggatgaaataacccctccattatca
cctgcaacgatgaatttgctaatggcaattggtcagaatcaccaacttacgcaactgatg
attcaactccagaaaatgccagaactacatagaacagaaatgttgactgcctataatagt
attaacctgccaggtttatatttggctataaattatggtaatgcggatatcgttgagact
attttcaattcattgtcagaaacaggatatgaaggattactctcgaaaaaaaatctcatg
catattctggaggcaaaagataaaaatggtttttctggattatttttagcgatatcacgt
aaggataaaaatgttgtaacctcgattctgaacgccttacctaaactggccgcaacacat
catttagataacgaacaagtgtataaattcctgagtgccaaaaatagaacgtccagccat
gttttataccatgttatggcgaatggtgatgccgacatgctgaaaattgttttgaacgcg
ttacctttgttaattcgcacatgtcatttgactaaagaacaggtactcgatctcctgaag
gcaaaggatttttatggttgcccaggactatatctggcgatgcaaaatggacatagcgat
atcgtgaaagttattcttgaagcattgcccagcctagcccaggaaattaacatttcagct
tccgatattgtagatcttctgaccgctaaaagtcttgcgcgcgacacgggtttgtttatg
gccatgcagcgcggacacatgaacgttattaatactatttttaacgcattacccactctg
tttaatacgtttaaattcgataaaaaaaatatgaagcccctcctcctggcaaataattct
aatgaatatcccggtttgttttcagcgatacagcataaacaacaaaatgttgtagagacg
gtttatcttgctttatctgaccatgcacgcctgtttggatttaccgctgaagatattatg
gatttttggcaacacaaagccccacaaaaatactctgcctttgagttggcttttgaattt
ggtcaccgggttattgctgaattaatccttaatacattaaataagatggctgaaagcttt
ggctttacggataaccctcgatacattgcggagaaaaattatatggaagctttactcaaa
aaagcatctccccataccgtacgctaa
              
                            

Download fasta file
RegulonDB