RegulonDB RegulonDB 10.10: Gene Sequence
rdcA gene sequence


Size: 2229        A: 537  T: 545  G: 598  C: 549

Fasta

 

>crfC E. coli K12. Version NC_000913.3 GI:556503834
atgtacacacagaccctgtatgagttaagtcaggaggctgaacgcctgttacagctttct
cgccaacagttgcagttactggaaaaaatgcctctctctgtacccggagacgacgcgcca
caactggctttaccctggagtcagcctaatatcgccgaacgtcacgcgatgctgaataat
gagttgcgtaaaatttcccgactggaaatggtgcttgcaattgtcggtaccatgaaagca
gggaaatcaaccaccattaatgccattgttggtacggaggttctgcctaatcgtaatcgc
ccaatgactgcgctgccgacgcttattcgccatacgcccgggcaaaaggaaccggtactg
catttttcacatgtcgcgccaatcgattgtttaattcaacaattacaacagcgcctgcgt
gattgcgatattaagcatctgaccgatgtgctggaaatagataaagatatgcgtgcgctt
atgcagcggatcgaaaatggcgtcgctttcgaaaaatattatctgggtgcccagcctatt
tttcattgtctgaaaagtttgaatgatttagtgcgactggcgaaggcgctggacgtcgat
tttcctttttctgcttacgccgccattgagcatattcccgtgattgaagtggagtttgtc
catctagcggggctggagagttatcccggtcagttgacgttactggatacccccgggcca
aatgaagccgggcaaccgcatctgcaaaaaatgcttaaccagcagctggcacgcgcctcg
gcggtactggcggtgctggattatacgcaactgaaatcgatctccgatgaagaggtccgt
gaggcgattttggcggtggggcaatcggtgccgctgtacgtgctggtcaataagttcgat
caacaggatcgtaacagtgacgacgccgaccaggtgcgggcactgatttccgggacgctg
atgaaaggctgtattacgccacagcagatatttccggtgtcgtcgatgtggggctacctg
gcgaatcgggcgcgctatgagttagccaacaacggtaagttaccaccgccagagcaacaa
cgctgggtggaagattttgcccatgccgcgcttggcaggcgctggcgtcatgccgatctg
gcggacctcgaacatattcgtcatgctgccgatcagttgtgggaagattcgctgttcgcc
cagccaattcaggcgttgcttcatgccgcttacgctaacgcctcgttgtatgctctgcga
tctgccgcgcataaactgttgaattacgcgcagcaggcgcgggaatacctggattttcgt
gcgcacgggttaaacgtcgcttgtgaacaattgcggcaaaatatccaccagatcgaagaa
agtttgcagctattgcaactcaatcaggcgcaggtgagcggcgagattaaacatgaaatc
gagctggccctgacctccgccaaccactttctgcgtcaacagcaagatgcgctgaaggtg
cagttagccgccttgtttcaggatgattcggagccgttaagcgagattcgtacccgctgt
gagacactgttacagacggcgcagaacaccatcagtcgcgactttacgctgcgttttgcc
gagcttgaatccaccctttgccgggtgttaaccgatgttattcgccccattgagcaacaa
gtcaaaatggaattgagcgagtcagggtttcgtcctgggtttcattttcctgtttttcac
ggcgtagttccccacttcaacactcgccagctgttcagtgaagtcatttcgcgccaggaa
gcaacggacgagcagagcacgcgtttaggcgttgtgcgtgagactttttcgcgctggttg
aatcagcccgactggggacggggaaatgagaaatcaccgacagaaacggttgattacagt
gtgttgcaacgagcattaagcgcagaagtcgatctctattgccaacaaatggctaaagtt
ctggcagagcaggtcgatgaatctgttacggcaggcatgaatacttttttcgctgagttc
gcttcatgtttgacggaattacagacgcgtttacgcgaaagtctggctctgcgtcaacaa
aatgaatcggtggtcaggctgatgcagcagcaattgcagcagactgtgatgactcacggc
tggatttacaccgacgcccagctgttacgcgatgatattcaaacacttttcacggcagaa
cgatattga
              
                            

Download fasta file
RegulonDB