RegulonDB RegulonDB 10.9: Gene Sequence
epmA gene sequence


Size: 978        A: 228  T: 235  G: 277  C: 238

Fasta

 

>epmA E. coli K12. Version NC_000913.3 GI:556503834
atgagcgaaacggcatcctggcagccgagcgcatccattcctaacttattaaaacgcgcg
gcgattatggcggagatccgtcgtttctttgccgatcgtggagtgctggaggtggagacg
ccttgtatgagccaggcgacggtaaccgatattcatttggtcccgtttgagacacgtttc
gttggccccgggcattcgcaggggatgaatctctggttaatgaccagcccggaataccat
atgaaacgcctgctggttgccggttgtgggccggtattccagctgtgccgcagcttccgt
aatgaagagatggggcgttatcacaaccctgagttcactatgctggagtggtatcgaccg
cactatgatatgtaccggttgatgaacgaggtggacgatctcttacaacaggtgctggac
tgcccggcagcagaaagcctttcttatcaacaagctttcttgcgttatctggaaattgac
ccgctctctgccgacaaaacgcaactgcgggaagtcgcagcgaaactggatttgagcaat
gttgctgataccgaagaagaccgcgacacgctgctacaattgctgtttacctttggcgta
gagccaaatattggcaaagaaaaaccgacctttgtgtaccactttccagccagccaggca
tcactggcgcaaatcagtaccgaagatcatcgggtcgctgaacgctttgaggtttattat
aaaggtattgagctggcgaatggtttccatgaattgacggatgcccgtgagcagcaacaa
cgctttgaacaagataaccgtaagcgcgcggcgcgcggtttgccgcagcaccccattgac
cagaatctgattgaagccttgaaagtcggtatgcctgactgttccggcgtggcattaggt
gttgatcgtctggtgatgttggcgctgggcgcggagacactggctgaagtcatcgccttt
agcgttgaccgggcataa
              
                            

Download fasta file
RegulonDB