RegulonDB RegulonDB 10.9: Gene Sequence
yjjB gene sequence


Size: 474        A: 85  T: 147  G: 129  C: 113

Fasta

 

>yjjB E. coli K12. Version NC_000913.3 GI:556503834
atgggtgtgatcgaatttctgttagcgttggcgcaggatatgatcctcgccgccattcct
gcggtcggctttgcgatggtgttcaacgttcccgtgcgggcgttacgctggtgtgcgctg
cttggctcgataggtcatggttcccgaatgatcttgatgaccagcgggttgaatattgag
tggtcaacctttatggcttctatgctggtcggtaccattggtattcaatggtcgcgctgg
tatctggcgcatccgaaagtgtttaccgtggcggccgttatccctatgttcccgggcata
tcggcttataccgcaatgatttcggcggtaaaaatcagccagttaggttacagcgaaccg
ttgatgattaccctgttaaccaactttcttacagcttcatcgattgttggtgcgttatcc
atcggtctttccattcctggattatggttgtaccgcaagcgccctcgcgtataa
              
                            

Download fasta file
RegulonDB