RegulonDB RegulonDB 10.9: Gene Sequence
zwf gene sequence


Size: 1476        A: 381  T: 332  G: 405  C: 358

Fasta

 

>zwf E. coli K12. Version NC_000913.3 GI:556503834
atggcggtaacgcaaacagcccaggcctgtgacctggtcattttcggcgcgaaaggcgac
cttgcgcgtcgtaaattgctgccttccctgtatcaactggaaaaagccggtcagctcaac
ccggacacccggattatcggcgtagggcgtgctgactgggataaagcggcatataccaaa
gttgtccgcgaggcgctcgaaactttcatgaaagaaaccattgatgaaggtttatgggac
accctgagtgcacgtctggatttttgtaatctcgatgtcaatgacactgctgcattcagc
cgtctcggcgcgatgctggatcaaaaaaatcgtatcaccattaactactttgccatgccg
cccagcacttttggcgcaatttgcaaagggcttggcgaggcaaaactgaatgctaaaccg
gcacgcgtagtcatggagaaaccgctggggacgtcgctggcgacctcgcaggaaatcaat
gatcaggttggcgaatacttcgaggagtgccaggtttaccgtatcgaccactatcttggt
aaagaaacggtgctgaacctgttggcgctgcgttttgctaactccctgtttgtgaataac
tgggacaatcgcaccattgatcatgttgagattaccgtggcagaagaagtggggatcgaa
gggcgctggggctattttgataaagccggtcagatgcgcgacatgatccagaaccacctg
ctgcaaattctttgcatgattgcgatgtctccgccgtctgacctgagcgcagacagcatc
cgcgatgaaaaagtgaaagtactgaagtctctgcgccgcatcgaccgctccaacgtacgc
gaaaaaaccgtacgcgggcaatatactgcgggcttcgcccagggcaaaaaagtgccggga
tatctggaagaagagggcgcgaacaagagcagcaatacagaaactttcgtggcgatccgc
gtcgacattgataactggcgctgggccggtgtgccattctacctgcgtactggtaaacgt
ctgccgaccaaatgttctgaagtcgtggtctatttcaaaacacctgaactgaatctgttt
aaagaatcgtggcaggatctgccgcagaataaactgactatccgtctgcaacctgatgaa
ggcgtggatatccaggtactgaataaagttcctggccttgaccacaaacataacctgcaa
atcaccaagctggatctgagctattcagaaacctttaatcagacgcatctggcggatgcc
tatgaacgtttgctgctggaaaccatgcgtggtattcaggcactgtttgtacgtcgcgac
gaagtggaagaagcctggaaatgggtagactccattactgaggcgtgggcgatggacaat
gatgcgccgaaaccgtatcaggccggaacctggggacccgttgcctcggtggcgatgatt
acccgtgatggtcgttcctggaatgagtttgagtaa
              
                            

Download fasta file
RegulonDB