RegulonDB RegulonDB 10.8: Gene Sequence
fdnG gene sequence


Size: 3048        A: 743  T: 654  G: 870  C: 781

Fasta

 

>fdnG E. coli K12. Version NC_000913.3 GI:556503834
atggacgtcagtcgcagacaattttttaaaatctgcgcgggcggtatggctggaacaaca
gtagcggcattgggctttgccccgaagcaagcactggctcaggcgcgaaactacaaatta
ttacgcgctaaagagatccgtaacacctgcacatactgttccgtaggttgcgggctattg
atgtatagcctgggtgatggcgcaaaaaacgccagagaagcgatttatcacattgaaggt
gacccggatcatccggtaagccgtggtgcgctgtgcccgaaaggggccggtttgctggat
tacgtcaacagtgaaaaccgtctgcgctacccggaatatcgtgcgccaggttctgacaaa
tggcagcgcattagctgggaagaagcattctcccgtattgcgaagctgatgaaagctgac
cgtgacgctaactttattgaaaagaacgagcagggcgtaacggtaaaccgttggctttct
accggtatgctgtgtgcctccggtgccagcaacgaaaccgggatgctgacccagaaattt
gcccgctccctcgggatgctggcggtagacaaccaggcgcgcgtctgacacggaccaacg
gtagcaagtcttgctccaacatttggtcgcggtgcgatgaccaaccactgggtggatatc
aaaaacgctaacgtcgtgatggtgatgggcggtaacgctgctgaagcgcatcccgtcggt
ttccgctgggcgatggaagcgaaaaacaacaacgacgcaaccttgatcgttgtcgatccc
cgttttacgcgtaccgcttctgtggcggatatttacgcgcctattcgttccggtacggac
attacgttcctgtctggcgttttgcgctacctgatcgaaaacaacaaaatcaacgccgaa
tacgttaagcattacaccaacgccagcctgctggtgcgtgatgattttgctttcgaagac
ggtctgttcagcggctacgacgctgaaaaacgtcaatacgataaatcgtcctggaactat
cagctcgatgaaaacggctatgcgaaacgcgatgaaacactgactcatccgcgctgtgtg
tggaacctgctgaaagagcacgtttcccgctacacgccggacgtcgttgaaaacatctgc
ggtacgccaaaagccgacttcctgaaagtgtgtgaagtgctggcctccaccagcgcaccg
gatcgcacaaccaccttcctgtacgcgctgggctggacgcagcacactgtgggtgcgcag
aacatccgtactatggcgatgatccagttgctgctcggtaacatgggtatggccggtggc
ggcgtgaacgcattgcgtggtcactccaacattcagggcttgactgacttaggcctgctc
tctaccagcctgccaggttatctgacgctgccgtcagaaaaacaggttgatttgcagtcg
tatctggaagcgaacacgccgaaagcgacgctggctgatcaggtgaactactggagcaac
tatccgaagttcttcgttagcctgatgaaatctttctatggcgatgccgcgcagaaagag
aacaactggggctatgactggctgccgaagtgggaccagacctacgacgtcatcaagtat
ttcaacatgatggatgaaggcaaagtcaccggttatttctgccagggctttaacccggtt
gcgtccttcccggacaaaaacaaagtggtgagctgcctgagcaagctgaagtacatggtg
gttatcgatccgctggtgactgaaacctctaccttctggcagaaccacggtgagtcgaac
gatgtcgatccggcgtctattcagactgaagtattccgtctgccttcgacctgctttgct
gaagaagatggttctatcgctaactccggtcgctggttgcagtggcactggaaaggtcag
gacgcgccgggcgaagcgcgtaacgacggtgaaattctggcgggtatctaccatcatctg
cgcgagctgtaccagtccgaaggtggtaaaggcgtagaaccgctgatgaagatgagctgg
aactacaagcagccgcacgaaccgcaatctgacgaagtggctaaagagaacaacggctac
gcgctggaagatctctatgacgctaatggcgtgcttattgcgaagaaaggtcagttgctg
agtagctttgcgcatctgcgtgatgacggtacaaccgcatcttcttgctggatctacacc
ggtagctggacagagcagggcaaccagatggctaaccgcgataactccgacccgtccggt
ctggggaatacgctgggatgggcctgggcgtggccgctcaaccgtcgcgtgctgtacaac
cgtgcttcggcggatatcaacggtaaaccgtgggatccgaaacggatgctgatccagtgg
aacggcagcaagtggacgggtaacgatattcctgacttcggcaatgccgcaccgggtacg
ccaaccgggccgtttatcatgcagccggaagggatgggacgcctgtttgccatcaacaaa
atggcggaaggtccgttcccggaacactacgagccgattgaaacgccgctgggcactaac
ccgctgcatccgaacgtggtgtctaacccggttgttcgtctgtatgaacaagacgcgctg
cggatgggtaaaaaagagcagttcccgtatgtgggtacgacctatcgtctgaccgagcac
ttccacacctggaccaagcacgcattgctcaacgcaattgctcagccggaacagtttgtg
gaaatcagcgaaacgctggcggcggcgaaaggcattaataatggcgatcgtgtcactgtc
tccagcaagcgtggctttatccgcgcggtggctgtggtaacgcgtcgtctgaaaccgctg
aatgtaaatggtcagcaggttgaaacggtgggtattccaatccactggggctttgagggt
gtcgcgcgtaaaggttatatcgctaacactctgacgccgaatgtcggtgatgcaaactcg
caaacgccggaatataaagcgttcttagtcaacatcgagaaggcgtaa
              
                            

Download fasta file
RegulonDB