RegulonDB RegulonDB 10.8: Gene Sequence
fdnH gene sequence


Size: 885        A: 209  T: 189  G: 265  C: 222

Fasta

 

>fdnH E. coli K12. Version NC_000913.3 GI:556503834
atggctatggaaacgcaggacattatcaaaaggtccgcaactaactccatcacgccgcct
tctcaggtgcgtgattacaaagcagaagtcgcaaaacttatcgacgtttccacctgtatc
ggctgtaaagcctgtcaggtggcgtgttcggagtggaacgacatccgtgatgaagtgggg
cactgcgtcggggtttacgataaccccgccgatctgagcgccaagtcctggacggtgatg
cgctttagcgaaaccgaacagaacggcaagctggagtggctgatccgtaaagacggctgt
atgcactgtgaagatcccggctgcctgaaggcgtgcccgtctgctggtgcaatcattcag
tacgctaacgggattgtcgatttccagtcggaaaactgcatcggctgtggttactgcatt
gccgggtgtccgtttaatattccgcgcctcaacaaagaggataaccgggtatataaatgc
acgctctgcgtcgatcgcgtcagcgtcggccaggaaccggcttgtgtgaaaacctgtccg
accggggctatccacttcggcaccaagaaggagatgctggagctggcggaacagcgcgtg
gcgaaactgaaagcgcgtggttacgaacatgctggcgtctacaacccggaaggggtcggt
ggtacgcacgttatgtacgtgctgcatcacgccgatcagccggagctgtatcacggtctg
ccgaaagatccgaagatcgacacctcggtaagcctgtggaaaggcgcgttgaaaccgctg
gcagcggctggctttattgccacttttgccgggttgattttccactacatcggtattggc
ccgaataaggaagtggacgatgacgaggaggatcatcatgagtaa
              
                            

Download fasta file
RegulonDB