RegulonDB RegulonDB 10.8: Gene Sequence
fdnI gene sequence


Size: 654        A: 155  T: 174  G: 186  C: 139

Fasta

 

>fdnI E. coli K12. Version NC_000913.3 GI:556503834
atgagtaagtcgaaaatgattgtgcgcaccaaatttattgatcgcgcctgtcactggacc
gtggtgatttgcttcttcctggtggcgctgtccgggatttcgttcttcttcccgacgctg
caatggctgacgcaaaccttcggtacgccgcagatgggacgcattttgcacccgttcttc
ggcattgcgattttcgtcgcactgatgtttatgtttgtgcgttttgtgcatcacaacatc
ccggataagaaagatattccgtggctgttgaacattgtcgaagtattgaaaggcaatgag
cataaagtggcggatgtcggtaagtacaacgccgggcaaaagatgatgttctggtcgatc
atgagcatgattttcgtgctgctggtgaccggggtgattatctggcgtccgtactttgcg
cagtacttcccgatgcaggttgttcgctacagcctgctgatccacgcggctgcgggtatc
atcctgatccacgccatcctgatccatatgtatatggcattttgggtgaaaggatcgatt
aaagggatgatcgaagggaaggtaagtcgtcgctgggcgaagaaacaccatccgcgctgg
tatcgtgaaatcgagaaggcagaagcgaaaaaagagagtgaagaagggatataa
              
                            

Download fasta file
RegulonDB