RegulonDB RegulonDB 10.8: Gene Sequence
rstB gene sequence


Size: 1302        A: 298  T: 344  G: 333  C: 327

Fasta

 

>rstB E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaactgtttatccagttttacctgttattgtttgtctgcttccttgtgatgtct
ctgctggttgggctggtgtacaaatttaccgccgaacgcgcgggcaaacagtcgctggat
gatttgatgaacagttcgctgtatctgatgcgcagcgaattgcgtgagatccccccacac
gactggggtaaaactctgaaagagatggatttaaatctctctttcgatctgcgtgtcgag
ccactgagtaaataccatcttgatgatatttccatgcaccgactgcgtggcggcgaaatt
gtcgccctggacgatcagtacacgtttttgcagcgtatcccgcgcagccactacgtgctg
gcagttggtcctgttccttatctttattatctccatcagatgcgattgctggatatcgcc
ctgatcgcttttattgctatttccctcgcctttccggtgtttatctggatgcgtccgcac
tggcaggatatgttaaaactggaagcagcggcgcaacgatttggcgatgggcatctcaat
gaacgtatccactttgatgagggttcgagctttgaacgacttggcgtcgcatttaaccag
atggcggacaatatcaacgccttaattgccagcaaaaaacagcttattgacggtatcgct
cacgaactgcgaacaccgttagtgcgcctgcgttatcgactggagatgagcgataacctg
agcgccgccgaatcccaggcgttgaatcgtgatatcagtcaacttgaagctttaattgaa
gagctgctgacttatgcccgactcgatcgcccacaaaacgagcttcatcttagcgaacca
gacctgccgttgtggctgtcaacgcatctggcagatattcaggcagtaacgcccgataaa
acggtacggataaaaacgctcgtgcaaggccattatgcggcgttggatatgcgcttaatg
gagcgcgtgctggataatttgctcaataacgccctgcggtactgccattcaacggttgaa
accagcctgctactgtcggggaatagagcgacattaattgttgaggatgatggcccaggg
attgccccagaaaaccgcgaacatatctttgaaccttttgttcgcctcgatcccagccgg
gatcgctcaaccggcggctgcgggctggggctggcaattgtccactctatagcactggca
atgggcggtacggttaattgtgacaccagcgaactgggtggtgcccgcttctcgtttagc
tggccgttatggcataacatcccgcaatttacctctgcctga
              
                            

Download fasta file
RegulonDB