RegulonDB RegulonDB 10.8: Gene Sequence
rhlE gene sequence


Size: 1365        A: 316  T: 275  G: 392  C: 382

Fasta

 

>rhlE E. coli K12. Version NC_000913.3 GI:556503834
atgtctttcgattctttgggtttaagccctgatatcctgcgcgccgttgccgagcagggt
taccgtgaacccacccctattcagcagcaggcgatccctgcggtgctggaaggccgcgac
ctgatggctagcgcccagaccggcaccggcaaaacagcgggctttacgctgccgctgttg
caacacctgatcactcgccagccgcacgccaaagggcgtcgtccggtacgtgcgctcatt
cttaccccgacccgtgaactggcggcgcagattggcgaaaacgtccgtgattacagcaaa
tacctgaacattcgttcgctggtggtgtttggtggtgtgagtattaacccgcagatgatg
aaactgcgtggcggcgttgatgtgctggtggcaaccccgggacgtttgctggacctggaa
catcagaatgcagtgaagctggatcaggttgaaatcctcgtcctcgatgaagctgaccgc
atgctcgacatgggctttatccacgatatccgtcgcgtgttaacaaaactacctgcgaag
cgccagaacctgttattctccgcgaccttctctgacgatattaaagccctggcggaaaaa
ctgttgcacaacccgctggaaatcgaagtggcacgccgcaataccgcgtctgatcaggtg
acccagcacgttcactttgtcgataagaaacgcaaacgcgaattgctgtcgcacatgatt
gggaaagggaactggcagcaggtgctggtgtttacccgtaccaaacacggcgctaaccat
ctggctgaacagctcaataaagatggcatccgtagtgcggcgatccacggcaataaatcg
caaggtgcgcgtactcgtgcgctggctgattttaaatcgggcgatattcgtgtactggtg
gcaactgacatcgctgcgcgcggcctggatattgaagagctgccgcacgtcgtcaactat
gaactgccaaacgtacctgaagattatgtccaccgtatcgggcgtaccggtcgtgcggct
gctaccggtgaagcgttgtcgctggtgtgtgttgatgaacacaaactgctgcgtgatatc
gaaaaactgctgaaaaaagagatcccgcgcattgcgattccgggctatgagccggacccg
tcaatcaaagccgaaccgatccagaacggtcgccagcaacgtggcggcggcggtcgtggg
caaggtggtggtcgcggtcaacagcaaccacgccgtggggaaggtggcgcaaaatctgca
agcgcgaaacctgcagaaaaaccgtctcgccgcctcggcgatgccaaaccggcaggcgaa
caacaacgtcgccgccgtccgcgtaaacctgccgctgcgcagtaa
              
                            

Download fasta file
RegulonDB