RegulonDB RegulonDB 10.8: Gene Sequence
ycaC gene sequence


Size: 627        A: 164  T: 173  G: 151  C: 139

Fasta

 

>ycaC E. coli K12. Version NC_000913.3 GI:556503834
atgaccaaaccgtatgttcgtcttgataaaaatgatgctgccgttttgcttgttgatcac
caggctggtttactttcccttgtacgggatatcgaacccgataagtttaaaaataacgtg
ctggcgctgggtgacctggctaagtatttcaacttaccaactattcttaccaccagtttt
gaaaccggtcctaacggcccattagttccagaactgaaagcacaattccccgatacacct
tacattgctcgcccgggaaatattaacgcctgggataacgaagattttgtaaaagctgtc
aaagcgacaggtaaaaaacagttaattattgccggtgtggtaaccgaagtttgcgtggca
ttcccggcgctttcagccattgaagaagggtttgacgtctttgtcgtgactgacgcgtca
gggacctttaatgaaattacccggcattcggcatgggatcgcttgtcgcaagctggtgcg
caattgatgacatggttcggcgtggcgtgcgagctgcatcgcgactggcgtaatgatatt
gaaggactggcgacgttgttctctaaccacattcctgattatcgtaatttgatgaccagt
tatgacacgttaacgaagcagaaataa
              
                            

Download fasta file
RegulonDB