RegulonDB RegulonDB 10.8: Gene Sequence
ycaD gene sequence


Size: 1149        A: 206  T: 345  G: 330  C: 268

Fasta

 

>ycaD E. coli K12. Version NC_000913.3 GI:556503834
atgtccacgtatacccagcctgtcatgcttttgctgtctggcctgcttttgttgactctg
gcgattgcggtgttaaatacactcgtgccgctttggctcgcccaggaacacatgtccaca
tggcaggtaggcgttgtcagctcatcctattttaccggcaaccttgtcggtacattgctg
acagggtatgtcattaagcgcattggctttaaccgcagctattatctggcctccttcatt
tttgccgctggctgtgccggccttggcctgatgattggattctggagctggttggcttgg
cgttttgtcgcgggcgtcggctgtgccatgatttgggtggttgttgagagcgcgctgatg
tgcagtgggacgtcacgtaaccgtgggcgtttgcttgctgcgtatatgatggtttattac
gtgggaacgtttttaggccagttactggtcagcaaagtttcaaccgagctgatgtccgta
ttgccgtgggttacaggtttgacgttggcagggatcttaccgctgttgtttacgcgtgtg
ctgaatcagcaggctgaaaaccatgattcgacgtcaattacgtcaatgctaaaactccgt
caggcgcggcttggcgtgaatggctgcattatctcaggaatcgttctgggatctctatat
ggcctgatgccgctgtacctcaatcacaaaggggtgagcaatgccagcattggtttctgg
atggcggtactggtcagtgcgggtatccttggacaatggccgattggacgtctggcggat
aagtttggtcgactgctggtgttgcgtgttcaggtctttgtcgtcattctcggcagtatc
gcgatgcttagccaggcggcgatggccccagcgttattcatcctcggtgccgctggcttt
acgctatatccggtggcgatggcatgggcttgcgagaaagttgaacatcatcaactggtg
gcgatgaaccaggccttactgttgagctatactgtgggaagtctgcttggcccgtcattt
accgctatgctaatgcagaatttctccgataatttattgtttatcatgatcgccagcgta
tcgtttatctatttgctgatgctgctgcgcaacgccggtcatacgccgaaacccgttgct
cacgtgtaa
              
                            

Download fasta file
RegulonDB