RegulonDB RegulonDB 10.9: Gene Sequence
uspE gene sequence


Size: 951        A: 258  T: 212  G: 251  C: 230

Fasta

 

>uspE E. coli K12. Version NC_000913.3 GI:556503834
atggctatgtatcagaacatgctcgttgttatcgatcctaaccaggacgaccaaccagca
ttgcggcgagctgtttatttacatcaacggattggtggcaaaattaaagcctttttgccg
atctatgacttctcatacgaaatgaccaccctgctctccccggacgaacgtaccgctatg
cgtcagggcgtcatcagccagcgtacagcctggatccacgagcaggcaaaatattatctc
aatgctggcgttcccattgaaattaaagtggtctggcataaccgtcctttcgaagccatc
attcaggaagtgatcagcggcggacacgatttggtgctaaaaatggcgcaccaacatgac
cgtctggaagcggtgatttttacgccaacggactggcatctgttacgcaaatgcccaagc
ccggtgtggatggtgaaagaccagccgtggccggaaggaggcaaggcgctggtggcggtg
aatctcgccagtgaagagccgtatcataatgcgctcaatgaaaaactggtcaaagagacg
atcgaactggcagaacaagtcaaccataccgaagttcatctggttggcgcttatccggta
acgccaattaatatcgcgattgaactgccggaatttgacccgagcgtttataacgatgcc
attcgtgggcaacatttgctggcaatgaaagccctgcggcagaaattcggcattaatgaa
aacatgacgcacgtagaaaaaggtctgccagaagaggtgattcctgatttggcggagcac
ttacaggcggggattgtggttctgggcacggtaggacgcaccggtatttcagcagcattc
ctcggcaacacggcggaacaggtgattgatcatcttcgctgcgacctgctggtcattaaa
cctgaccagtatcagacacccgttgaactggatgacgaagaagacgattaa
              
                            

Download fasta file
RegulonDB