RegulonDB RegulonDB 10.8: Gene Sequence
rlmD gene sequence


Size: 1302        A: 331  T: 301  G: 349  C: 321

Fasta

 

>rlmD E. coli K12. Version NC_000913.3 GI:556503834
atggcgcaattctactctgcaaaacgacgcacgacgacgcgtcagatcataaccgtttca
gtcaacgacctcgactcttttggtcagggcgtggcgcgacataacggcaaaacgctattt
atccccggattattgccgcaggaaaacgcggaagttactgttactgaagataaaaaacag
tatgcccgcgctaaagtcgtacgccggttaagcgatagcccggaacgcgaaacgccacgc
tgtcctcattttggcgtatgcggtggctgtcagcaacaacacgccagcgtggatttacag
cagcgaagcaaaagtgcggcactcgcccgattaatgaaacacgatgtctctgaagtgatc
gccgatgttccctggggctatcgccgtcgcgcgcgtttaagtctgaactacttaccgaaa
acacagcaacttcagatggggtttcgcaaagcgggctccagtgacattgtcgacgtcaaa
caatgccccattttagcgccccaacttgaagcattgctgcccaaagtcagggcatgtctg
ggcagcttacaagctatgcgccatcttggtcatgttgaactggtacaggcaaccagcggc
acgctgatgattttgcgccataccgcaccgctaagttcggcagatcgcgaaaaactggaa
cgcttttcgcattctgaaggcctggatctgtatctcgcccccgatagtgagatactcgaa
accgtctctggtgagatgccctggtatgactcaaacgggttgcgcttaacttttagcccg
cgcgattttattcaggtcaatgcgggtgtgaaccaaaaaatggtagcgcgtgcgttggaa
tggctggatgtgcaacctgaagatcgcgtactggatctgttctgcggtatgggcaacttt
acactgccattggcgacacaagctgccagtgtggtcggtgtagaaggtgttccggcgctg
gtggaaaaaggccagcagaatgcgcgtcttaatggcttacagaatgtgacgttttatcac
gaaaatcttgaagaagatgtcacaaagcagccgtgggcgaaaaacggcttcgataaagtg
ttgctggacccggcgcgagcaggtgccgcaggtgttatgcagcaaattataaaactggaa
cctattcgtatagtttatgtatcctgtaaccctgcaacgctggctcgggatagcgaagcg
ttattaaaagcaggatataccattgcgcgactggcgatgctggatatgttcccacacacg
ggacatctggaatcgatggtacttttctcgcgcgttaaatag
              
                            

Download fasta file
RegulonDB