RegulonDB RegulonDB 10.8: Gene Sequence
mazF gene sequence


Size: 336        A: 99  T: 82  G: 89  C: 66

Fasta

 

>mazF E. coli K12. Version NC_000913.3 GI:556503834
atggtaagccgatacgtacccgatatgggcgatctgatttgggttgattttgacccgaca
aaaggtagcgagcaagctggacatcgtccagctgttgtcctgagtcctttcatgtacaac
aacaaaacaggtatgtgtctgtgtgttccttgtacaacgcaatcaaaaggatatccgttc
gaagttgttttatccggtcaggaacgtgatggcgtagcgttagctgatcaggtaaaaagt
atcgcctggcgggcaagaggagcaacgaagaaaggaacagttgccccagaggaattacaa
ctcattaaagccaaaattaacgtactgattgggtag
              
                            

Download fasta file
RegulonDB