RegulonDB RegulonDB 11.1: Gene Sequence
chpS gene sequence


Size: 252        A: 74  T: 51  G: 70  C: 57

Fasta

 

>chpS E. coli K12. Version NC_000913.3 GI:556503834
atgcgtattaccataaaaagatgggggaacagtgcaggtatggtcattcccaatatcgta
atgaaagaacttaacttacagccggggcagagcgtggaggcgcaagtgagcaacaatcaa
ctgattctgacacccatctccaggcgctactcgcttgatgaactgctggcacagtgtgac
atgaacgccgcggaacttagcgagcaggatgtctggggtaaatccacccctgcgggtgac
gaaatatggtaa
              
                            

Download fasta file
RegulonDB