RegulonDB RegulonDB 10.8: Gene Sequence
focA gene sequence


Size: 858        A: 185  T: 253  G: 217  C: 203

Fasta

 

>focA E. coli K12. Version NC_000913.3 GI:556503834
gtgaaagctgacaacccttttgatcttttacttcctgctgcaatggccaaagtggccgaa
gaggcgggtgtctataaagcaacgaaacatccgcttaagactttctatctggcgattacc
gccggtgttttcatctcaatcgcattcgtcttctatatcacagcaaccactggcacaggc
acaatgcccttcggcatggcaaaactggttggcggcatttgcttctctctggggctgatt
ctttgtgttgtctgcggagccgatctctttacttccaccgtgttgattgttgttgctaag
gcgagtgggcgcatcacctggggtcagttggcgaaaaactggctaaatgtctattttggc
aacctggtcggcgcactgctgtttgtacttttaatgtggctttccggcgagtatatgacc
gcaaatggtcaatggggactaaacgtcctacaaaccgccgaccacaaagtgcaccatact
tttattgaggccgtctgtcttggtatcctggcaaacctgatggtatgtctggcagtatgg
atgagttattctggccgcagcctgatggacaaagcgttcattatggtgctgccggtcgcg
atgtttgttgccagcggttttgagcacagtatcgcaaacatgtttatgatcccgatgggt
attgtaatccgcgacttcgcatccccggaattttggaccgcagtcggttctgcaccggaa
aatttttctcacctgaccgtgatgaatttcatcactgataacctgattccggttacgatc
ggcaacattatcggtggtggtttgttggttgggttgacatactgggtcatttacctgcgt
gaaaacgaccaccattaa
              
                            

Download fasta file
RegulonDB