RegulonDB RegulonDB 10.9: Gene Sequence
ilvL gene sequence


Size: 99        A: 20  T: 26  G: 32  C: 21

Fasta

 

>ilvL E. coli K12. Version NC_000913.3 GI:556503834
atgacagcccttctacgagtgattagcctggtcgtgattagcgtggtggtgattattatc
ccaccgtgcggggctgcacttggacgaggaaaggcttag
              
                            

Download fasta file
RegulonDB