RegulonDB RegulonDB 10.7: Gene Sequence
hyfB gene sequence


Size: 2019        A: 364  T: 550  G: 569  C: 536

Fasta

 

>hyfB E. coli K12. Version NC_000913.3 GI:556503834
atggatgccctgcaattattaacctggtcgctgattctctatctgtttgctagtctggct
tcgctgtttttactcggtctggacagactggctattaagctttccggcatcacatcgctg
gtgggcggcgtgattggcatcatcagcggaattacgcaattacatgctggtgtaacttta
gtcgcccgttttgcccccccttttgaatttgccgatttaaccctgcgaatggatagcctc
tcggcatttatggtgctggttatctccttgctggtggtggtttgttctctctattcattg
acttatatgcgcgaatacgagggcaaaggcgcggcggcgatgggcttctttatgaatatt
ttcatcgcatcgatggttgccctgctggtgatggacaacgctttttggttcatcgtgctg
tttgaaatgatgtcgctgtcttcctggtttctggtcattgccaggcaggataaaacgtcg
atcaacgctggcatgctctacttttttatcgcccacgccggatcggtgctgataatgatc
gccttcttgctgatggggcgcgaaagcggcagcctcgattttgccagtttccgcacgctt
tcactttctccggggctggcgtcggcggtgttcctgctggcctttttcggttttggcgcg
aaagccgggatgatgccgttgcacagctggttgccgcgcgctcaccctgccgcaccatcg
cacgcttcggcgttgatgtctggcgtaatggtcaaaataggtattttcggcatcctgaaa
gtagcgatggatctgctggcgcaaacgggtttgcctctgtggtggggcattctggtgatg
gcgatcggcgcaatctccgcgctcctgggcgtgctatatgcgctggcggaacaggatatc
aaacggctgctggcctggagtaccgtcgaaaacgtcggcattattttgctggcagtcggt
gtggcgatggtcggtctgtcactgcacgacccgctgctcaccgtggttggactgctcggc
gcactgtttcatctgctcaaccatgcgctgttcaaagggctgctatttctcggcgcggga
gcgattatttcgcgtttgcatacccacgacatggaaaaaatgggggcactagcgaaacgg
atgccgtggacagccgcagcatgcctgattggttgcctcgcgatatcagccattcctccg
ctgaatggttttatcagcgaatggtacacctggcagtcgctgttctcactaagtcgtgtg
gaagccgtagcgctacaacttgcgggtcctattgctatggtaatgctggcagtcactggt
gggctggcagtaatgtgcttcgtaaaaatgtacggtattactttctgtggtgcgccgcgc
agtacacacgctgaagaggcacaggaagtgccaaatacgatgatcgtcgccatgctactg
ctcgcggcactctgcgtattaattgcgcttagtgccagttggctggcaccgaagataatg
catattgcccatgcgtttaccaatacccctcccgccactgtcgccagcggaatagcactt
gtacccggcacgtttcatacacaggtcaccccctcattactgttgctgttactactggcg
atgcctttgctgcctggcctttactggctgtggtgtcgttcgcgccgcgcagcgtttcgt
cgcacaggagatgcctgggcatgcggctacggctgggaaaatgcgatggccccgtcaggc
aatggcgtgatgcagccgctgcgtgtggtcttttctgcgctatttcgtctacgacaacag
ctcgaccctacgctgaggctaaataaaggtcttgcgcacgtcaccgccagggctcagagc
acagaacccttctgggatgagcgggtgatccgccccatcgtgagcgccacccaacggctg
gccaaagaaatacagcatctgcaaagcggcgactttcgtctctattgcctgtatgtggtc
gccgcactggttgtgctgctaatcgctattgccgtctaa
              
                            

Download fasta file
RegulonDB