RegulonDB RegulonDB 10.9: Gene Sequence
rhaT gene sequence


Size: 1035        A: 211  T: 289  G: 304  C: 231

Fasta

 

>rhaT E. coli K12. Version NC_000913.3 GI:556503834
atgagtaacgcgattacgatggggatattttggcatttgatcggcgcggccagtgcagcc
tgtttttacgctccgttcaaaaaagtaaaaaaatggtcatgggaaaccatgtggtcagtc
ggtgggattgtttcgtggattattctgccgtgggccatcagcgccctgttactaccgaat
ttctgggcgtattacagctcgtttagtctctctacgcgactgcctgtttttctgttcggc
gctatgtgggggatcggtaatatcaactacggcctgaccatgcgttatctcggcatgtcg
atgggaattggcatcgccattggcattacgttgattgtcggtacgctgatgacgccaatt
atcaacggcaatttcgatgtgttgattagcaccgaaggcggacgcatgacgttgctcggc
gttctggtggcgctgattggcgtagggattgtaactcgcgccgggcagttgaaagagcgc
aagatgggcattaaagccgaagagttcaatctgaaaaaagggctggtgctggcggtgatg
tgcggcattttctctgccgggatgtcctttgcgatgaacgccgcaaaaccgatgcatgaa
gccgctgccgcacttggcgtcgatccactgtatgtcgctctgccaagctatgttgtcatc
atgggcggcggcgcgatcattaacctcggtttctgttttattcgtctggcaaaagtgaag
gatttgtcgctaaaagccgacttctcgctggcaaaatcgctgatcattcacaatgtgtta
ctctcgacactgggcgggttgatgtggtatctgcaattctttttctatgcctggggccac
gcccgcattccggcgcagtatgactacatcagttggatgctgcatatgagtttctatgta
ttgtgcggcggtatcgtcgggctggtgctgaaagagtggaacaatgcaggacgccgtccg
gtaacggtgttgagcctcggttgtgtggtgattattgtcgccgctaacatcgtcggcatc
ggcatggcgaattaa
              
                            

Download fasta file
RegulonDB