RegulonDB RegulonDB 10.8: Gene Sequence
purB gene sequence


Size: 1371        A: 347  T: 307  G: 351  C: 366

Fasta

 

>purB E. coli K12. Version NC_000913.3 GI:556503834
atggaattatcctcactgaccgccgtttcccctgtcgatggacgctacggcgataaagtc
agcgcgctgcgcgggattttcagcgaatatggtttgctgaaattccgtgtacaagttgaa
gtacgttggctgcaaaaactggccgcgcacgcagcgatcaaggaagttcctgcttttgct
gccgacgcaatcggttaccttgatgcaatcgtcgccagtttcagcgaagaagatgcggcg
cgcatcaaaactatcgagcgtaccactaaccacgacgttaaagcggttgagtatttcctg
aaagaaaaagtggcggagatcccggaactgcacgcggtttctgaattcatccactttgcc
tgtacttcggaagatatcaataacctctcccacgcattaatgctgaaaaccgcgcgtgat
gaagtgatcctgccatactggcgtcaactgattgatggcattaaagatctcgccgttcag
tatcgcgatatcccgctgctgtctcgtacccacggtcagccagccacgccgtcaaccatc
ggtaaagagatggcaaacgtcgcctaccgtatggagcgccagtaccgccagcttaaccag
gtggagatcctcggcaaaatcaacggcgcggtcggtaactataacgcccacatcgccgct
tacccggaagttgactggcatcagttcagcgaagagttcgtcacctcgctgggtattcag
tggaacccgtacaccacccagatcgaaccgcacgactacattgccgaactgtttgattgc
gttgcgcgcttcaacactattctgatcgactttgaccgtgacgtctggggttatatcgcc
cttaaccacttcaaacagaaaaccattgctggtgagattggttcttccaccatgccgcat
aaagttaacccgatcgacttcgaaaactccgaagggaatctgggcctttccaacgcggta
ttgcagcatctggcaagcaaactgccggtttcccgctggcagcgtgacctgaccgactct
accgtgctgcgtaacctcggcgtgggtatcggttatgccttgattgcatatcaatccacc
ctgaaaggcgtgagcaaactggaagtgaaccgtgaccatctgctggatgaactggatcac
aactgggaagtgctggctgaaccaatccagacagttatgcgtcgctatggcatcgaaaaa
ccgtacgagaagctgaaagagctgactcgcggtaagcgcgttgacgccgaaggcatgaag
cagtttatcgatggtctggcgttgccagaagaagagaaagcccgcctgaaagcgatgacg
ccggctaactatattggtcgagctatcacgatggttgatgagctgaaataa
              
                            

Download fasta file
RegulonDB