RegulonDB RegulonDB 10.8: Gene Sequence
fabD gene sequence


Size: 930        A: 212  T: 205  G: 285  C: 228

Fasta

 

>fabD E. coli K12. Version NC_000913.3 GI:556503834
atgacgcaatttgcatttgtgttccctggacagggttctcaaaccgttggaatgctggct
gatatggcggcgagctatccaattgtcgaagaaacgtttgctgaagcttctgcggcgctg
ggctacgacctgtgggcgctgacccagcaggggccagctgaagaactgaataaaacctgg
caaactcagcctgcgctgttgactgcatctgttgcgctgtatcgcgtatggcagcagcag
ggcggtaaagcaccggcaatgatggccggtcacagcctgggggaatactccgcgctggtt
tgcgctggtgtgattgatttcgctgatgcggtgcgtctggttgagatgcgcggcaagttc
atgcaagaagccgtaccggaaggcacgggcgctatggcggcaatcatcggtctggatgat
gcgtctattgcgaaagcgtgtgaagaagctgcagaaggtcaggtcgtttctccggtaaac
tttaactctccgggacaggtggttattgccggtcataaagaagcggttgagcgtgctggc
gctgcctgtaaagcggcgggcgcaaaacgcgcgctgccgttaccagtgagcgtaccgtct
cactgtgcgctgatgaaaccagcagccgacaaactggcagtagaattagcgaaaatcacc
tttaacgcaccaacagttcctgttgtgaataacgttgatgtgaaatgcgaaaccaatggt
gatgccatccgtgacgcactggtacgtcagttgtataacccggttcagtggacgaagtct
gttgagtacatggcagcgcaaggcgtagaacatctctatgaagtcggcccgggcaaagtg
cttactggcctgacgaaacgcattgtcgacaccctgaccgcctcggcgctgaacgaacct
tcagcgatggcagcggcgctcgagctttaa
              
                            

Download fasta file
RegulonDB