RegulonDB RegulonDB 10.10: Gene Sequence
fabG gene sequence


Size: 735        A: 182  T: 174  G: 214  C: 165

Fasta

 

>fabG E. coli K12. Version NC_000913.3 GI:556503834
atgaattttgaaggaaaaatcgcactggtaaccggtgcaagccgcggaattggccgcgca
attgctgaaacgctcgcagcccgtggcgcgaaagttattggcactgcgaccagtgaaaat
ggcgctcaggcgatcagtgattatttaggtgccaacggcaaaggtctgatgttgaatgtg
accgacccggcatctatcgaatctgttctggaaaaaattcgcgcagaatttggtgaagtg
gatatcctggtcaataatgccggtatcactcgtgataacctgttaatgcgaatgaaagat
gaagagtggaacgatattatcgaaaccaacctttcatctgttttccgtctgtcaaaagcg
gtaatgcgcgctatgatgaaaaagcgtcatggtcgtattatcactatcggttctgtggtt
ggtaccatgggaaatggcggtcaggccaactacgctgcggcgaaagcgggcttgatcggc
ttcagtaaatcactggcgcgcgaagttgcgtcacgcggtattactgtaaacgttgttgct
ccgggctttattgaaacggacatgacacgtgcgctgagcgatgaccagcgtgcgggtatc
ctggcgcaggttcctgcgggtcgcctcggcggcgcacaggaaatcgccaacgcggttgca
ttcctggcatccgacgaagcagcttacatcacgggtgaaactttgcatgtgaacggcggg
atgtacatggtctga
              
                            

Download fasta file
RegulonDB