RegulonDB RegulonDB 10.8: Gene Sequence
nrdR gene sequence


Size: 450        A: 111  T: 108  G: 131  C: 100

Fasta

 

>nrdR E. coli K12. Version NC_000913.3 GI:556503834
atgcattgcccattctgtttcgccgtggacactaaggtaattgactctcgtctcgtgggc
gagggttcatccgtacgccgccgtcggcagtgtctggtgtgtaatgaacgtttcaccacc
tttgaagtggcggagctggttatgccgcgtgttgtaaaaagcaacgacgtgcgtgaaccg
tttaatgaagagaaattgcgtagcggaatgctgcgggcgctggaaaaacgtccggtgagt
tccgatgacgtcgaaatggcaatcaatcatattaaatcgcagctgcgcgccaccggtgag
cgcgaagtgccgagcaagatgattggcaatctggtgatggagcaattgaaaaagctcgat
aaagtcgcctatatccgttttgcctctgtctaccgcagtttcgaagatatcaaagaattt
ggcgaagagatcgcgcgcctggaggactaa
              
                            

Download fasta file
RegulonDB